what is the difference between molar mass and empirical formula mass of a compound
in prostate tests psa what is the difference between total psa and free psa
... recommendations for tPSA cutoffs and interpretation of the fPSA/tPSA ratio The aim of our study was to compare commercially available automated methods for PSA concentrations (total and free) ... PSA is problematic because PSA is really an organ-specific marker for the prostate rather than a specific marker for cancer Controversy exists regarding the medical decision levels for tPSA and ... of calibration against a universal standard In an effort to standardize PSA methods, the World Health Organization (WHO) developed a standard, the WHO (90:10) (National Institute for Biological...
- 4
- 563
- 0
Báo cáo y học: "Where is the difference between the genomes of humans and annelids" pot
... between an organism’s morphological and functional complexity and the absolute size of its genome Some invertebrates have a genome size comparable to that of humans [10,11] The well-known example of ... of the unicellular Amoeba dubia, with a genome 200 times larger than that of humans [9], demonstrates that mere DNA length does not determine an organism’s complexity The major fraction of an animal ... Jeffares et al [17] have recently reviewed the process of intron gain and loss They and others have demonstrated that intron evolution is not a simple stochastic process, and that a number of...
- 2
- 384
- 0
what is the relationship between teachers’ different corrective feedback types and students uptake and repair
... both the state of the learner’s knowledge and of the ways in which the second language is being learned “Error” in English language teaching is a mark of a learner’s transitional competence as distinct ... probably claim that their aim was to learn to speak accurately and fluently at the same time Another consideration when deciding what to correct is the nature of errors and how ready or capable ... feedback have motivated the present study Of particular relevance is Lyster and Ranta’s (1997) study of corrective feedback and learner uptake and, specifically, their analytical model of error...
- 44
- 533
- 0
What is the neutral real interest rate, and how can we use it? doc
... course, the disinflationary impact of the Asian crisis of of the NRR Hawkesby et al assume that there is no default the late 1990s may counter-balance the impact of these or liquidity premium between ... expand on the above distinction and clarify between actual and potential output is known as the “output alternative concepts of the neutral real interest rate We gap” If actual output is greater ... Zealand’s NRR is to take estimates of the NRR for Australia and the United States 23 Table Estimates of New Zealand’s NRR NRR estimate Average NRR estimate Method 1: Estimates based on historical...
- 14
- 539
- 0
What explains the association between socioeconomic status and depression among vietnamese adults
... ethics applications; measurement design and development; data collection, data management and analyses; interpretation of results and the preparation of this thesis This PhD research program and the ... revised DSM-IV-TR Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, text revision EFA Exploratory factor analysis FA Factor analysis xiv What explains the association between ... Supervisor) and Professor Michael Dunne (Associate Supervisor) at the School of Public Heath, Queensland University of Technology, Australia, and A Professor Vo Van Thang (Associate Supervisor), at...
- 360
- 279
- 0
What are the differences between British English and American English? pptx
... to talk about roads and motorways Someone I know took over hours to complete a 25 minute drive, because he didn't know what his sat nav system meant when it said "Take the ramp" Another huge difference ... windscreen zip student moving van eraser garbage knapsack sedan report card Scotch tape stocks free time garters panty hose can candy apple bathroom flashlight pants undershirt rubber boots windshield ... huge difference that causes great confusion is writing the date When you write the date in numbers British and American English differ To write the date 7th of September 2007 a Brit would write...
- 2
- 472
- 3
Báo cáo y học: " Research How is the balance between protein synthesis and degradation achieved" ppt
... even a small persistent imbalance between the rates of synthesis and degradation of proteins is inimical to cellular and organismal life1 Over the past half-century we have learned a great deal about ... explicitly asked This even though in the fullness of time balance between the rates of manufacture and destruction, between what is made and what is broken down occurs and is quantitative whatever the ... as a matter of logic and our understanding of physical and chemical kinetics The principal conclusion to be drawn from this analysis is that through the agency of mass action and the conservation...
- 11
- 303
- 0
Báo cáo y học: "All duplicates are not equal: the difference between small-scale and genome duplicatio" docx
... of this paper Additional data file shows a comparison of the shared interaction ratio for duplicates and random ORF pairs Additional data file shows the semantic distance distributions for each ... maintain the function of the ancestral gene Alternatively, when dosage is not advantageous, they may diverge and either (second reason) gain a new function or (third reason) assume part of the ... (the fraction of all genes associated with that term) and S(t1, t2) is the set of all parent terms shared by t1 and t2 For two genes a and b with sets of annotated terms A and B, we define the...
- 13
- 357
- 0
229. The Difference Between Giving Credit and Taking Credit ppsx
... student or professor caught plagiarizing might be told to leave and never return Using information from experts is usually OK, as long as where the material came from is identified Any material copied ... Punishments for plagiarism differ in schools A high school student might fail the project A college student might fail the class and be suspended for a year In some colleges and universities, a ... word-for-word is supposed to appear inside quotation marks Where people get in trouble is when they try to claim other people's words as their own IN THE NEWS in VOA Special English was written by Nancy...
- 2
- 335
- 0
Báo cáo khoa học: Bridging the gap between in silico and cell-based analysis of the nuclear factor-jB signaling pathway by in vitro studies of IKK2 ppt
... from the global t The constant a is the ratio of apparent dissociation constants for binding GST-IjBa in the presence and absence of ATP, and the value of a indicates whether the binding of one ... GST-IjBa in the presence and app absence of ATP K m is the apparent dissociation constant for full length GST-IjBa substrate at saturation concentration of 60 lM ATP, and the dissociation constant ... Immunocytochemical staining of A5 49 cells and analysis of the dynamics of NF-jB nuclear translocation (A, B) Doseresponse data from A5 49 stimulated with IL- 1a and xed with formaldehyde (A) and MeOH ...
- 13
- 475
- 0
Báo cáo lâm nghiệp:"An examination of the interaction between climate, soil and leaf area index in a Quercus ilex ecosystem" ppt
... 154 C Hoff and S Rambal fall and leaf quantity [33, 43] Important then are the timing of rainfall and drought events, the quantity of rainfall, the storage capacity of the soil and quantity and ... relations between the LAI and both climatic and soil factors; (2) understand how the water and carbon balances behave as a function of water availability and LAI; and (3) define how the balance between ... stomata are open Stomata closure limits transpiration, but also limits carbon assimilation Thus, there is a trade-off between water loss and carbon assimilation at the scale of the leaf [9, 10] At...
- 9
- 486
- 0
Báo cáo khoa học: Substrate specificity of the human UDP-glucuronosyltransferase UGT2B4 and UGT2B7 Identification of a critical aromatic amino acid residue at position 33 doc
... CTGGTGTGGCCCACAGAATACAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG CTGGTGTGGGCAGCAGAACTCAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGAGTTCTGCTGCCCACACCAG CTGGTGTGGGCAGCAGAATACAGCCATTGGATGAATATAAAG ... Mutant Primer Sequence (5’- to 3’) 2B4F33 L Sense Antisense Sense Antisense Sense Antisense Sense Antisense CTGGTGTGGCCCACAGAACTCAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGAGTTCTGTGGGCCACACCAG ... enhanced apparent affinity of the mutant For both substrates, the mutation decreased the Vmax values On the other hand, the Vmax of the mutant towards 17-epiestriol was slightly increased and the...
- 9
- 343
- 0
What is Health Literacy? Health literacy is the ability to read, understand, and act on health care information. pdf
... and the Medicaid Checklist2 assess how readable and understandable education materials are, and also evaluate how well materials stimulate learning and motivation and whether the materials are ... understandable for patients A few tools are available to measure the readability of materials as well as the health literacy of the patients Evaluating the suitability of education materials for the audience1,2 ... Furnas S, and McClellan F Literacy, Health, and the Law: An Exploration of the Law and the Plight of Marginal Readers within the Health Care System: Advocating for Patients and Providers Health...
- 18
- 877
- 0
WORKING PAPER SERIES NO. 548 / NOVEMBER 2005: THE LINK BETWEEN INTEREST RATES AND EXCHANGE RATES DO CONTRACTIONARY DEPRECIATIONS MAKE A DIFFERENCE? doc
... data characterising the situation in some Asian EMEs, namely, Malaysia, South Korea (henceforth Korea) and Thailand, during the Asian crisis (19971998) The Asian crisis is best characterised as ... has taken place alongside adverse shocks to risk premia In the case of Korea and Thailand at the time of the Asian crisis, the picture is similar to the case of an adverse risk premium shock alone, ... experience of some Asian EMEs at the time of the Asian crisis (1997-1998), that of some Latin American countries at the time of the Asian crisis (1997), the Russian default (1998) and a couple of periods...
- 55
- 444
- 0
What Is the Cognitive Neuroscience of Art… and Why Should We Care? ppt
... imagination, affect, emotion) are involved (exalted) in AE? What is the relationship between AE and evaluation? What is the articulation of the natural and cultural bases of AE? Has AE the same ... and multidisciplinary debates What is AE for? Is AE an adaptation or a by-product? What is the relationship between AE and the goal of knowing? Has AE a mental distinctiveness? What mental processes ... conceive of a neural system in which landscape paintings would not activate the parahippocampal place area and that facial portraits not activate the fusiform face area, parts of the brain that respond...
- 20
- 801
- 0
Free Movement of Goods and Their Use – What Is the Use of It? pptx
... of a separate approach is that a clear distinction is drawn between more classic health and life issues and specific safety issues This view only strengthens the argument that the case-law-based ... is coherent in its approach Then logical reasoning disappears and the Grand Chamber defers to the Italian arguments wholesale, almost giving the appearance of a compromise; the rejection of the ... turn, affects the access of that product to the market of that Member State[,]” is also found in paragraph 56 of Commission v Italy, in paragraph 57 the Grand Chamber made it clear that the measure...
- 42
- 760
- 0
Health and Quality of Life Outcomes BioMed Central Research Open Access What is the relationship docx
... size statistic relates change over time to the standard deviation of baseline scores The standardised response mean compares change to the standard deviation of change The responsiveness statistic ... practice The interpretation of HRQoL scores raises many issues [1–7] The scales and instruments used may be unfamiliar to many clinicians and patients, who may be uncertain of the meaning of the ... an HRQoL measure and an independent measure (or anchor) to elucidate the meaning of a particular degree of change Thus anchor-based approaches require an independent standard or anchor that is...
- 8
- 484
- 0
What qualities and skills are needed for the managers to manage people? • What is the importance of good human resources management
... Recruitment and training Staff training is an integral part of the overall development strategy of the business Staff are not trained or not trained fit is the main cause leading to the current state ... Good organization • • A manager must be able to plan, direct, coordinate, and organize through out the day 1 Good organization Summary, organization is an important management quality because keeping ... There are many kinds of conflict, a good manager is a person who can aware what are the best ways to resolve conflicts logically Resolving conflict may include: listen for what is felt as well as...
- 33
- 3,880
- 10
Báo cáo y học: "What is the clinical and ethical importance of incidental abnormalities found by knee MRI" docx
... OA were imaged on at least one occasion, and 123 were imaged on at least two occasions The mean age of healthy participants was 56.1 years (standard deviation [SD] 7.3) The mean age of OA participants ... drafting and revision All authors read and approved the final manuscript Acknowledgements This study was supported by the National Health and Medical Research Council (NHMRC) (Australia) and the ... formal plans to deal with the ongoing management of these incidental lesions at many levels, incorporating clinical, ethical, and financial aspects Whilst, based on these data, the prevalence of...
- 6
- 466
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25