... following primers: 2.1up, AAACATATGCTATATTACAATAAAA GG; 2.2up, AAACATATGTTATCTATCGTTGTAAAGC; 2.3up, AAACATATGCTTGTTCCTCAAAAACTTCC; 3.3rv, AAACTCGAGGACCTTAGCCGTAGTCTTCAC; 3.2rv, AAACTCGAGTTTTCCATTCAAAACCGTG ... Functional and structural characterization ofthe catalytic domain ofthe starch synthase III from Arabidopsis thaliana Proteins 70, 31–40 Senoura T, Asao A, Takashima Y, Isono N, Hamada S, Ito ... triplicate and the average values ± SD are reported [19,39] SS activity was determined using a radiochemical method [44] All kinetic parameters arethe means of at least three determinations and are...
... tolerance and immune inhibition inthe induction of oral tolerance inthe murine CIA model We examined the change inthe expression of IDO in CD11c+ DCs of Peyer's patches after repeated oral administration ... tarsal bone, = moderate edema and erythema from the ankle to the tarsal bone, and = edema and erythema from the ankle to the entire leg The sum ofthe values from three legs, excluding the hind ... 4:1206-1212 Yoshida R, Nukiwa T, Watanabe Y, Fujiwara M, Hirata F, Hayaishi O: Regulation of indoleamine 2,3-dioxygenase activity inthe small intestine and the epididymis of mice Arch Biochem Biophys...
... contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated ... (ggcaggaattgaatgcag) or the known 3¢ end ofthe xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes on the C acidovorans plasmid was established using the AlkPhos Fig Location ofthe ... and characterization of xanthine dehydrogenase ina baculovirus-insect cell system In Flavins and Flavoproteins 1993 Proceedings ofthe 11th International Symposium on Flavins and Flavoproteins...
... kDa to 78 kDa and are comprised ofa structural and a functional domain: the T-domain, and a transcriptional activator or repressor domain The crystallographic structure ofthe T-domain ofthe ... specification; and a parallel pathway model, where a cell initially assesses its position within the gastrula and interpretation of this information leads to the parallel activation ofa fate specification ... maternal Wnt signalling (Miller et al, 1999) Induction ofthe A- P axis occurs at the onset of gastrulation and involves a combination of several pathways, including the Wnt signalling pathway...
... cyclosporine) Anticoagulants (such as warfarin) Iron Drugs used to manage migraine headaches (such as ergotamine) Nonsteroidal anti -in ammatory drugs (NSAIDs) Garlic Anticoagulants (such as warfarin) ... native to Asia, where it has a long history of medicinal use, as documented in ancient medical treatises from India and China In traditional Chinese and Indian medicine, branches ofthe herb are ... investigators calculated mean values for the maximal plasma concentration, the time to reach the maximal plasma concentration, the area under the plasma concentration–time curve, the elimination of half-life,...
... mobility ofthe domains inthe crystal; the PYR domain has the lowest average B-factor, ˚ 23 A2 (comparable to the B-factor of bound ThDP), whereas the middle domain has the highest overall B-factor, ... such large-scale conformational changes during catalysis, and these structural features explain the lack of substrate activation in ZmPDC In IPDC, the assembly ofthe subunits inthe tetramer ... three-dimensional structure ofthe corresponding intermediate in transketolase [37] and themodel derived for ScPDC [38] (Fig 6) Inthe immediate vicinity ofthe modelled a- carbanion/enamine, there are a...
... termination codons arein bold letters The start and direction of each ORF are indicated by horizontal arrows and named accordingly Putative )10 and )35 regions of ata12 and ataPKS1 are overlined Restriction ... putative ribosomal binding sites, )10 and )35 regions, consensus sequences, etc., are indicated in Fig ataP3, ataP4, and ataP5 encode peptides (AtaP3, AtaP4 and AtaP5) that are highly similar ... previously arein dashed boxes Cosmids pCAR11 and pCAR13, which contain the A2 0 1A resistant determinants ard2 and ard1, respectively, are modified from Barrasa et al [12,13] As a comparison, the gene...
... when the rate of amylopectin synthesis becomes minimal At these moments the rates of amylopectin synthesis are only 5% of their maximal values In fact this low rate of amylopectin polymerization ... followed the kinetics of amylose synthesis over a 5-day period of nitrogen starvation and measured the amounts of starch, amylose, the kmax ofthe starch fractions, the degree of crystallinity and the ... h in vitro synthesis of amylose appear highly distorted and partly fused into a network This demonstrates that at least part ofthe synthesis can occur at the surface ofthe granule The apparent...
... construction ofthe domains A0 and B0 that at the point r the boundaries of Ax0 and B x0 are tangent to each other and that this tangency is quadratic We will look for the map h0 near the point r inthe ... properties ofthe quadratic maps which the ordinary unimodal maps not enjoy: • Quadratic maps are analytic and they have nondegenerate critical point; • Quadratic maps have negative Schwarzian derivative; ... inthe 2-to-1 way onto the domain A (so that there is a critical point of g inthe central domain), • All other components of B are mapped univalently onto A by the map g, • The iterates of the...
... either alanine or serine residues C10 6a, 5¢-TAGAGGGGGCTA AAACAAAA-3¢; c21 2a, 5¢-ACTGTGCACTCGGCGTG AGC-3¢; c21 4a, 5¢-ACTGTGGCCTCGCAGTGAGC-3¢; c23 5a, 5¢-TAGGAGCCACCACTGTCCTC-3¢; c33 0a, 5¢-CAGAGTCCCTCCAGCCTGCC-3¢; ... fragment ofthe plasmid pGIR201protA (a gift from H Kitagawa, Kobe Pharmaceutical University) [22,23], containing a cDNA encoding the insulin signal sequence and the Protein A- IgG binding domain, ... structural features ofthe GT1 motif in GalNAc-T1 are similar to the UBD, raising the possibility that catalytic mechanisms similar to those described above are conserved inthe GalNAc-transferases as...
... “How can we reduce the amount of garbage?” are often asked The expression “minimizing waste” is governing many trends, in each phase ofthe chain Customers, who are becoming more and more aware, ... rain that swamped the northern half of Queensland at the start ofthe year made its way south over the ensuing months and finally filled Brisbane’s dams If it hadn’t, the water grid and desalination ... delivered in air-tight bags packed in heavy cardboard The market for bag -in- box – BIB – has virtually exploded bag -in- box packaging fi rst saw the light of day inthe US inthe mid-1950s Back then,...
... consumption was analysed The corresponding values are shown in Fig After 15 of incubation inthe presence of 3.5 lm Ca2+ in an air atmosphere, state respiration of brain mitochondria was decreased to ... contradictory results Consequently, the initial enthusiasm for the use of antioxidants to treat acute brain injury subsided As a reason for the failure, the bioavailability of antioxidants was ... mitochondria This work was conducted in accordance with the regulations ofthe National Act, the use of Experimental Animals (Germany) Mitochondria were prepared from the brains of 220–240 g male Wistar...
... motifs (A) RNA-binding ofthe HCF152 and truncated parts containing different amounts of PPR motifs were analyzed ina UVcrosslinking assay to [32P]BDd RNA Increasing amounts of proteins, as indicated ... concentration and analyzed by SDS/PAGE and autoradiography Inthe lane marked ÔinputÕ, 5% ofthe corresponding 35 S-labeled protein was analyzed Inthe lanes marked Ô-Õ, the thioredoxin protein was incubated ... calibrated with the following protein standards: thyroglobolin, 669 kDa; catalase, 232 kDa; aldolase, 158 kDa; bovine serum albumin, 67 kDa and casein, 30 kDa Analyzing the protein–protein interaction...
... droplet-targeting proteins, perilipin and fatty acid-binding protein (FABP) are expressed at late and mature stages of lipid droplet formation Interestingly, we found that the mRNA level of adipophilin ... using a free-glycerol determination kit, according to the manufacturer’s instructions (Sigma) Statistical analysis All values are given as mean ± SE Paired samples were analyzed using the paired-sample ... human adipocyte differentiation F Li et al mRNA in 3T3-L1 adipocytes, whereas the expression ofa dominant-negative mutant of PPARc results ina decrease inthe amount of Fsp27 mRNA in 3T3-L1 adipocytes...
... S, Kawamura Y, Sato S, Wang R, Saido TC, Oyama F, Sakaki Y, Komano H & Yanagisawa K (1998) Presenilin mutations linked to familial Alzheimer’s disease increase the intracellular levels of amyloid ... 2009 The Authors Journal compilation ª 2009 FEBS 5839 Synoviolin is involvedinthe degradation of nicastrin T Maeda et al 23 Sai X, Kokame K, Shiraishi H, Kawamura Y, Miyata T, Yanagisawa K & ... Hrd1 enhances the degradation and suppresses the toxicity of polyglutamine-expanded huntingtin Exp Cell Res 313, 538–550 Yamasaki S, Yagishita N, Sasaki T, Nakazawa M, Kato Y, Yamadera T, Bae E,...
... to the increased Sp1 binding to GC boxes and DNase II promoter activity Other mechanisms, such as interactions with other factors, may also be involvedin increasing the DNA binding and transcriptional ... both basal and PMA-mediated induction of DNase II transcription These sites bind Sp1 and Sp3, and protein levels and binding of Sp1 and Sp3 are increased in PMAtreated cells These findings indicate ... used, bands C2 and C3 disappeared and bands SC 3a and SC3b appeared (lane 12) Coaddition ofthe two antibodies resulted inthe loss of bands C1, C2, and C3 (lane 13) In contrast, the use ofa control...
... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... splice variants (Pfu Ultra system; Stratagene) Upper primer 5¢-CACCGCCG CCACCATGGGATTGTCACGCAAATCATCAGATGC ATCT-3¢ and lower primer 5¢-TTAAAATTCACCA AATTCTTTTGCACATT-3¢ yielded Cb3ab and Cb3abD4, ... Supplementary material The following supplementary material is available online: Fig S1 Comparison of human and Rhesus monkey PKA Cb amino acid sequence This material is available as part ofthe online...
... Residues involvedinthe binding of D-glucose to the super-open conformation The 3D structure has revealed that GK is a typical two-domain enzyme and, inthe unliganded state, the L- and S-domains are ... steady-state kinetic parameters as well as the Kd value for Glc inthe ITF binding assay (Fig 2C), and the GST fusion proteins were therefore mostly used inthe kinetic analyses of mutant proteins ... mutations N20 4A, D20 5A, N23 1A and E25 6A ⁄ K resulted in enzyme forms that not bind Glc at all at physiological concentrations of Glc and they are essentially catalytically inactive Only inthe range 200–1600...
... UORF3:4093 ATCACCAATCCATAATGCATG DORF3:2768 ATGTAATCAGCATCGAAGACG DORF3:3434 GCGTATTAAGAACTTACAAGG 2951:DORF 3A AACTCAACAAGATAGTCAAAC 2951:UORF 3A ATGATAAAGTACTCAATGGTG Primers used to amplify and ⁄ or ... UORF4:3684 TCAATTTGCTCATGTAATGGC 2951:UORF 4A ACAGGACAGCCCAAATATAAG 2951:UOrf4B AAAAGGTGTCGTAATCTCACC 2951:DOrf4B GTGAGATTACGACACCTTTTG DORF4:4515 TTTCTAGATTTATACCATGGTG DORF4:4132 AAAAGAAGACAAACAAGCAGC ... mutant M catarrhalis, because the spectrum lacked an N-acetamido methyl peak at p.p.m that would have been indicative ofa GlcNAc being retained at the terminal position ofthe (1 fi 4) chain Additionally,...