wealth land and labor 2 money 3 sources of wealth 4 the farmer a producer and seller 5 business methods essential

Báo cáo y học: " Barriers and facilitators to evidence based care of type 2 diabetes patients: experiences of general practitioners participating to a quality improvement program" ppt

Ngày tải lên : 11/08/2014, 05:21

... Implementation Science 20 09, 4: 41 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Leykum LK, Pugh J, Lawrence V, Parchman M, Noel PH, Cornell J, McDaniel RR Jr: Organizational interventions ... Workplace Solo practice (N) Two man practice (N) Group practice (N) S2 (N = 5) S3 (N = 5) S4 (N = 5) All interviewees (N = 20 ) All participants (N = 120 ) 46 45 48 36 44 44 45 % 3 0 1 7 38 % 32 % 30 % ... type diabetes N Engl J Med 20 03, 34 8 :38 3 -39 3 Colagiuri S, Best J: Lipid-lowering therapy in people with type diabetes Curr Opin Lipidol 20 02, 13: 617- 6 23 23 24 25 26 27 28 29 30 Gaede P, Lund-Andersen...

11
400
0

ĐỀ THI THỬ ĐẠI HỌC+GIẢI CHI TIẾT-THPT TRIỆU SƠN 2-LẦN 3 môn vật lý (4)

Ngày tải lên : 31/07/2015, 21:05

... phản ứng sau : n + 92 U → 53 I + 39 Y +30 n Khối lượng hạt tham gia phản ứng: mU = 23 4, 9 933 2u; mn = 1,0087u; mI = 138 ,8970u; mY = 93, 89014u; uc2 = 931 ,5 MeV Nếu có lượng hạt nhân U 2 35 đủ nhiều, ... 22 : Một vật dao động theo phương trình x = 20 cos( A ω1 = 2 Z L1 Z C1 B ω1 = 2 Z C1 Z L1 C ω1 = 2 Z L1 Z C1 D ω1 = 2 Z C1 Z L1 23 5 139 94 Câu 24 : Biết đồng vị urani U 2 35 bị phân hạch theo ... Trang 3/ 6 - Mã đề thi 35 7 5 π ) A B i2 = 2 cos(100πt + ) A 12 π 5 C i2 = cos(100πt + ) A D i2 = 2 cos(100πt + ) A 12 Câu 31 : Một lắc lò xo treo trần thang máy Khi thang máy đứng yên lắc dao...

6
520
0

Paleoclimate, part 2 from 3 million years ago to the instrumental period

Ngày tải lên : 04/12/2015, 00:37

... 10.1 126 /science.1 141 038 Greenland and Antarctica vary together from glacial to interglacial, but are out of phase during the abrupt climate changes of the last glacial period Abrupt climate changes in Greenland are ... climates and warmings? 22 References Alley, R.B 20 04 GISP2 Ice Core Temperature and Accumulation Data IGBP PAGES/World Data Center for Paleoclimatology Data Contribution Series #20 04- 0 13 NOAA/NGDC ... (20 01) Atmospheric CO2 Concentrations over the Last Glacial Termination Science, 29 1 (55 01), 1 12 1 14 doi:10.1 126 /science .29 1 .55 01.1 12 23 MIT OpenCourseWare http://ocw.mit.edu 12. 34 0 Global Warming...

24
179
0

Tài liệu Freedom of Expression on the Internet - A study of legal provisions and practices related to freedom of expression, the free flow of information and media pluralism on the Internet in OSCE participating States ppt

Ngày tải lên : 18/02/2014, 00:20

... (Applications nos 14 52 6 /07, 147 47/07, 15 022 /07, 15 737 /07, 36 137 /07, 4 7 24 5/ 07, 5 037 1/07, 5 03 72/ 07 and 54 637 /07), Chamber Judgment of 20 .10 .20 09, paras 39 - 45 Cumpănă and Mazăre v Romania, no 33 348 /96, § ... June 20 03; Obukhova v Russia, no 34 736 / 03, § 28 , January 20 09, and Case of Ürper and Others v Turkey, (Applications nos 14 52 6 /07, 147 47/07, 15 022 /07, 15 737 /07, 36 137 /07, 4 7 24 5/ 07, 5 037 1/07, 5 03 72/ 07 ... (17.9%) of the participating States 31 32 33 34 35 36 37 38 See Editorial Board of Pravoye Delo and Shtekel v Ukraine, Application no 33 0 14/ 05, Judgment of 05. 05 .20 11, para 63 See Handyside v UK, App...

238
2.7K
0

Health-related behavior and quality of life among the elderly: a population-based study pot

Ngày tải lên : 05/03/2014, 21:20

... 19.6 14 69 .4 30 .6 65. 8 10.6 23 .5 54 . 1 14. 5 31 .4 >4 58 .4 41.6 49 .4 17 .3 33 .2 59 .1 10 .3 30.6 Active 69.9 30 .1 55 .4 12. 7 31 .9 52 . 4 16.1 31 .5 Inactive 67 .2 32 . 8 64. 9 12. 8 22 .3 51 .7 14 .3 34. 0 Homemaker ... 67 .2 32 . 8 58 .8 12. 5 28 .7 50 .2 18 .3 31 .5 7079 69.1 30 .9 66 .5 12. 8 20 .6 56 .7 11 .3 32 . 0 80 or more 75. 1 24 .9 73. 9 13. 5 12. 6 59 .5 8 .2 32 . 3 03 77.1 22 .9 73. 1 10 .5 16 .3 50 .5 15 .4 34 .1 48 66.8 33 .2 61 .2 ... 6 45 33 .3 (29 .1 ;37 .4) 80 or more 22 1 10.8 (08 .2; 13. 3) 03 844 42 . 6 (37 .4; 47.9) 48 759 38 .2 ( 34 .5 ;41 .4) or more 35 4 19.0 ( 14. 7 ; 23 .3) Age (years) The analyses were performed using svy commands of...

9
507
0

Báo cáo khoa học: The natural mutation by deletion of Lys9 in the thrombin A-chain affects the pKa value of catalytic residues, the overall enzyme’s stability and conformational transitions linked to Na+ binding pdf

Ngày tải lên : 07/03/2014, 12:20

... ﬂuorescence at 3 42 nm (Fig 2) The apparent equilibrium dissociation constant of Na+ binding was calculated using a single site binding equation and was 22 .0 ± 1 .5 and 24 ± 2. 6 mm for WT and DK9 thrombins, ... residues, located at the boundary between the A- and B-chains and interacting with Arg 137 via three water structural molecules having low mobility (w 32 1 , w 32 5 , and w4 54 ) [ 12] , have been shown ... drawn according to the best-ﬁt parameters values of Eqns (2 4) and listed in Table The vertical bars are the standard errors of the determinations 160 FEBS Journal 27 3 (20 06) 159 –169 ª 20 05 FEBS...

11
553
0

báo cáo hóa học:" Medication quality and quality of life in the elderly, a cohort study" doc

Ngày tải lên : 20/06/2014, 15:20

... Mental State Examination (MMSE); 1) median, 2) mean men (%) 1) 27 ( 23 - 28 ) 2) 25 .6 (3. 8) 1) 26 ( 23 - 28 ) 2) 25 .2 (3. 5) 1) 27 ( 23 - 29 ) 2) 25 .3 (4. 6) 1) 27 ( 24 - 29 ) 2) 26 .2 (3. 1) Clock Drawing Test ... Mean Median n= A (lowest MAI score) 55 .8 50 .0 47 61.0 60.0 33 63 .2 60.0 32 B (medium MAI score) 51 .2 50 .0 43 51 .7 50 .0 32 51 .0 50 .0 32 C (highest MAI score) 46 .2 50 .0 46 45 .2 50 .0 29 51 .7 50 .0 ... (%) 24 28 33 unable to (%) 11 no problems (%) 48 56 31 some problems (%) 35 20 33 unable to (%) 17 24 36 none (%) 31 22 22 moderate (%) 54 54 58 extreme (%) 15 24 20 none (%) 54 46 45 moderate...

9
381
0

The book of qt 4 the art of building qt applications - phần 2 docx

Ngày tải lên : 13/08/2014, 08:21

... create a new label, we look for the Display Widgets group (at the bottom of the box) and pull the Label entry onto the dialog via drag and drop Figure 3 .2: The dialog contains the ﬁrst widgets 82 3. 1 ... creating complex dialogs and layouts You can add widgets in the Designer via drag and drop and set their properties For example, you can change the text of a QLabel or its color and typeface ... function calls and thus identify passages in the source code that are to be translated Figure 1. 12: The Qt Linguist enables applications to be translated into other languages 50 1 .5 Qt at a Glance...

45
377
0

The book of qt 4 the art of building qt applications - phần 3 pptx

Ngày tải lên : 13/08/2014, 08:21

... we call the new slot manually so that the label can obtain an initial status After we have entered updateStats() as a slot in the class declaration of MainWindow, we must now ﬁnd a way of having ... point of view is again a “black box.” The crucial difference is in the declaration of the class We declare the class generated by uic as a private member of a QDialog subclass This allows for abitrary ... allows the basic graphical framework of most applications to be put together “by mouse click” in Qt versions 4. 1 and later The basis of this is the QMainWindow Qt class 4. 1 The Anatomy of the Main...

45
308
0

Tài liệu Activity 3.2: Identifying Sources of Information doc

Ngày tải lên : 24/01/2014, 10:20

... 18 Activity 3 .2: Identifying Sources of Information Exercise 1: Identifying Sources of Information ! Develop a list of sources of information Review the information in the Ferguson and Bardell, ... Ferguson and Bardell, Inc case study In the following table, list examples for each source of information You will discuss your results in a class discussion Sources Examples Artifacts Systems People...

2
346
0

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Ngày tải lên : 19/02/2014, 02:20

... primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT ... QuickChange kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5 -CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC -3 and its complement for His6Ala; 5 -GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC -3 and ... Hasegawa Y, Zhang H & Liu A (20 06) a- Amino-b-carboxymuconic-e-semialdehyde decarboxylase (ACMSD) is a new member of the Human ACMSD 22 23 24 25 26 27 28 29 30 31 32 amidohydrolase superfamily...

14
601
0

Crestron C2COM-2 & C2COM-3 2-Series RS-232/422/485 Expansion Cards Operations & Installation Guide.This document was prepared and written by the Technical Documentation department at:Crestron Electronics, Inc. 15 Volvo Drive Rockleigh, NJ 07647 1-888- doc

Ngày tải lên : 03/04/2014, 11:20

... Functions and Features The C2COM -2 and C2COM -3 RS - 23 2/ 42 2 /48 5 expansion cards provide RS - 23 2, RS- 42 2 , or RS -48 5 serial communication for a Crestron® 2- Series control system (PRO2, RACK2, PAC2, or AV2 ... (CTS) RS - 23 2 Clear to Send (TXD-) RS- 42 2 Transmit Data (Idles low) To C2COM -2/ 3 From C2COM -2/ 3 From C2COM -2/ 3 Ground To C2COM -2/ 3 From C2COM -2/ 3 To C2COM -2/ 3 From C2COM -2/ 3 *RS- 42 2 transmit and receive ... the IBM PC AT connector except for the RS 42 2 signals on pins 1, 4, 6, and Operations & Installation Guide - Doc 81 92 2-Series RS - 23 2/ 42 2 /48 5 Expansion Cards: C2COM -2/ 3 • 2- Series RS - 23 2/ 42 2 /48 5...

20
462
0

Read and Write A Letter By English (Phần 2) part 3 pptx

Ngày tải lên : 10/07/2014, 22:20

7
260
1

Assessment sources of air, water and land pollution doc

Ngày tải lên : 13/07/2014, 20:20

0
366
0

Dimensioning and Tolerancing Handbook Episode 2 Part 3 potx

Ngày tải lên : 21/07/2014, 15:20

... from the Y 14. 5. 1 standard directly into their software We are not yet aware of the actual extent of usage of the mathematical tolerance definitions from the Y 14. 5. 1 standard among CAE software ... T and A , and a radius r such that all of the points of the v actual feature consist of a subset of these points P , then the feature meets the cylindricity tolerance 7 .4. 5 .3 Flatness A flatness ... Requirement 9 .2. 2 Gap ≥ 0 05 Gap ≥ Gap ≥ 20 0 Gap ≥ Gap ≥ and ≤ 020 Loop Diagram The loop diagram is a graphical representation of each analysis Each requirement requires a separate loop diagram Simple...

25
354
1

Metal Machining - Theory and Applications Episode 2 Part 3 pot

Ngày tải lên : 21/07/2014, 17:20

... 0.99 0.88 2. 48 1. 43 1. 04 0. 72 3 .22 2. 06 3. 04 4 .21 Childs Part 28 :3 :20 00 3: 17 pm Page 24 5 Machinability analysis of free cutting steels 24 5 8 .3 .2 Simulated analysis of free cutting actions Figures ... 0.019 0 .33 9 0. 32 1 0. 32 3 – – – 0. 0 25 – 1 45 1 24 – Fig 8. 12 Specimen preparation for high speed compression testing Childs Part 28 :3 :20 00 3: 17 pm Page 24 2 24 2 Applications of finite element analysis ... lead is added to the steel Childs Part 28 :3 :20 00 3: 17 pm Page 24 4 24 4 Applications of finite element analysis Fig 8. 15 Relations between σt and τt at cutting speeds of (a) 100 m/min and (b) 20 0...

20
425
0

Friction and Lubrication in Mechanical Design Episode 2 Part 3 docx

Ngày tải lên : 05/08/2014, 09:20

... 10. 43 1 10 .30 3 10 .29 3 4. 641 8 4. 54 9 5 4. 43 6 7 4. 43 8 5 4. 031 9 3. 97 05 3. 956 7 E' and U are the modulus of elasticity and Poisson's ratio Coating material properties are used for E2 and u2 because coating ... rnl at T1 and m2 at T2 (where T1 and T2 are absolute temperature, say, K = 27 3. 16 "C, ml and m2 are kinematic viscosity in centi9 + + 30 4 Chapter 19 20 21 22 23 7.9 stokes), substitute ml, T l and ... 28 1 RollinglSliding Contacts Table 7 .3 Values of a and b for Some Commonly Used Lubricant Oils Oil SAE 10 SAE 20 SAE 30 SAE 40 SAE 50 SAE 60 SAE 70 b a ~~ ~ 11.768 11 .5 83 11 . 35 5 I 1 .39 8 10. 43 1 ...

25
402
0

Gear Noise and Vibration Episode 2 Part 3 pot

Ngày tải lên : 05/08/2014, 09:20

... [D3/r 32 ] (V3 r3) + [D 34/ r 32 ] (V3r3-V4r3) + [k 34/ r 32 ] (s3r3-s4r3) = - F 23 [I4/r 42 ] (A4 .r4) + [D4/r 42 ] (V4 r4) + [D 34/ r 42 ] (V4r4-V3r4) + [k 34/ r 42 ] (s4r4-s3r4) = + F 45 Lightly Loaded Gears 197 [I5/r 52 ] ... (Al.r2) + [Dl/r 22] (VI r2) + [D 12/ r 22] (Vlr2-V2r2) + [k !2/ r 22] (slr2-s2r2+te) - Q/r2 [I2/r 22] (A2 .r2) + [D2/r 22] (V2 r2) + [D 12/ r 22] (V2r2-Vlr2) + [k !2/ r 22] (s2r2-slr2-te) = - F 23 [I3/r 32 ] (A3 .r3) ... (V3-V4) = - F 23 r3 14 A4 + D4 V4 - k 34 (s3-s4) - D 34 (V3-V4) = F 45 r4 15 A5 + D5 V5 + k5 (s5) + = F 45 r5 Divide throughout by base circle radii to get "linear" equations and take rl=r2 [Il/r 22] (Al.r2)...

20
415
0