v— is the percentage of dca in serum a valid marker for the percentage of dca in bile

INTERLEUKIN 6 RELEASE FROM t98g HUMAN GLIAL CELL LINE AS a PREDICTIVE MARKER FOR CHRONIC PAIN, AND THE CHARACTERIZATION OF SUBSTANCE(S) INVOLVED IN PAIN

Ngày tải lên : 02/10/2015, 17:15

... are many others that play an important role in modulating chronic pain Amino acids and prostaglandins are two such examples 1.2.1.1 Amino Acids Glutamate is the main excitatory amino acid in the ... aspartate, arginine, asparagine, tyrosine and valine were also demonstrated to be elevated in the CSF of chronic pain patients as compared to that of acute pain patients On the other hand, GABA ... steroid therapy for PHN pain, the mechanisms for differing efficacy of the steroid therapy among patients should be ascertained The importance of biological markers in enabling the early diagnosis of...

136
600
0

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Ngày tải lên : 23/03/2014, 15:21

... shown) The behavior of this band in the diatom is thus similar to that of the PsbPlike protein in cyanobacteria [3,12] The fact that C gracilis, P gyrans, L japonica and U pinnatiﬁda contained bands ... proteins in the algae of red lineage which contain Haptophyta, diatoms and brown algae and are characterized by chlorophyll a ⁄ c The psbP gene is present in some of the algae in the red lineage ... merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae...

11
501
0

Báo cáo sinh học: "Glutamate carboxypeptidase activity in human skin biopsies as a pharmacodynamic marker for clinical studies" docx

Ngày tải lên : 18/06/2014, 19:20

... readily detected (Figure 3A) and the chromatographic peaks of 2-PMPA and internal standard (Figure 3B) allowed for quantitation of material in the Rojas et al Journal of Translational Medicine ... glutamate in a simple enzymatic assay that can be carried out in a standard biochemistry laboratory Finally, the older procedure involved measurements of NAAG levels as surrogate markers of GCP activity; ... performed using a Waters ACQUITY UPLC (Milford, MA, USA) Separation of the analytes from potentially interfering material was achieved at ambient temperature using a Waters Altantis column (100...

8
406
0

báo cáo hóa học:" Glutamate carboxypeptidase activity in human skin biopsies as a pharmacodynamic marker for clinical studies" doc

Ngày tải lên : 20/06/2014, 03:20

... readily detected (Figure 3A) and the chromatographic peaks of 2-PMPA and internal standard (Figure 3B) allowed for quantitation of material in the Rojas et al Journal of Translational Medicine ... glutamate in a simple enzymatic assay that can be carried out in a standard biochemistry laboratory Finally, the older procedure involved measurements of NAAG levels as surrogate markers of GCP activity; ... performed using a Waters ACQUITY UPLC (Milford, MA, USA) Separation of the analytes from potentially interfering material was achieved at ambient temperature using a Waters Altantis column (100...

8
304
0

The Art of Public Speaking cylinder, piston, water, and fire, is the steam−engine in its most elementary form. For a steam−engine may be defined as an apparatus for doing work by means of heat applied to water; and since raising such a weight as the pisto

Ngày tải lên : 08/08/2012, 17:20

5
1.3K
3

Tài liệu Báo cáo khoa học: Interruption of triacylglycerol synthesis in the endoplasmic reticulum is the initiating event for saturated fatty acid-induced lipotoxicity in liver cells pdf

Ngày tải lên : 14/02/2014, 22:20

... uptake of saturated and unsaturated FFAs into the cells After their internalization, FFAs are converted to fatty acyl-CoA, a reaction catalyzed by ACS Fatty acyl-CoAs are activated forms of fatty ... Mantzaris et al Ctrl A SA OA SA/OA B 6h 3h SA/OA OA Counts Ctrl SA/OA Ctrl SA SA 24 h 12 h 36 h SA/OA OA OA SA/OA Ctrl OA Ctrl SA/OA Ctrl OA SA SA SA FL1-Log Fig Stearate (SA) supplementation interrupts ... incorporation of palmitate (16:0) into the TAG pool only in the presence of oleate [18] The above results raise two main questions: (a) what is the cause of TAG synthesis inhibition, and (b) what is...

12
721
0

Tài liệu Research " The Dissertation Committee for Fang Yin Certifies that this is the approved version of the following dissertation: Business Value of Information Technology in the Internet Economy " doc

Ngày tải lên : 18/02/2014, 11:20

... as the base for the IT capital measure These data are available in the 10K reports of the publicly traded companies Almost all the companies list the beginning and ending book values of all hardware, ... dollars using the chain-type price indices for “Information processing equipment 22 and software” from the Bureau of Economic Analysis (BEA) Then the average of the beginning and ending values is used ... is estimated using the pooled data In that case, it is desirable to consider the actual labor cost Since no labor expense data are available from the financial statements, industry average labor...

163
731
0

Tài liệu Báo cáo khoa học: "Is the End of Supervised Parsing in Sight?" pdf

Ngày tải lên : 20/02/2014, 12:20

... address The notation A@ k denotes the node at address k where A is the nonterminal labeling that node A new nonterminal is created for each node in the training data This nonterminal is called Ak 402 ... a shared parse forest A shared parse forest can be obtained by adding pointers from each node in the chart (or tabular diagram) to the nodes that caused it to be placed in the chart Such a forest ... hand-annotated data At the same time U-DOP* significantly outperforms the supervised DOP* if evaluated in a practical application like MT We argued that this can be explained by the fact that...

8
525
0

Báo cáo khoa học: Arabidopsis thaliana CYP77A4 is the ﬁrst cytochrome P450 able to catalyze the epoxidation of free fatty acids in plants potx

Ngày tải lên : 07/03/2014, 03:20

... plants might help to understand the physiological role of CYP7 7A4 This lack of data could 728 V Sauveplane et al explain the small amount of information available today concerning the ability of ... the basis of the peak area of each metabolite detected by GC Metabolites of linoleic acid For the analysis of the products generated by recombinant CYP7 7A4 on incubation with linoleic acid, the ... a void plasmid under the same growth conditions Metabolism of lauric acid by CYP7 7A4 To validate the hypothesis of CYP7 7A4 being a fatty acid-metabolizing enzyme, we incubated radiolabeled lauric...

17
544
0

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Ngày tải lên : 07/03/2014, 05:20

... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... and have the AAA domain helix and the C-terminal helix, but not the b domain The distinguishing feature of members of the meiotic clade of AAA ATPases is the SRH motif, which differs from that ... sequences as well as the Arg residues in the SRH (red) and Walker A and B motifs (black) are shown The colour code for the remainder of the protein is: large AAA subdomain, pink; small AAA subdomain,...

23
490
0

Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deﬁcient strain of Saccharomyces cerevisiae and study of its complementation pdf

Ngày tải lên : 08/03/2014, 23:20

... AACEVAPD1 AACEVAPD3 AACEVAPD2 AACEVAPD5 AACEVAPD4 AACEVAPD6 Vma3p Vma11p Vma16p 100 97 80 80 80 80 50 50 32 100 94 93 93 54 51 28 AACEVAPD5 AACEVAPD2 AACEVAPD3 AACEVAPD1 Table Alignments of the ... preparation of recombinants in yeast expression vector In the case of AACEVAPD1, and 6, TAA is used as an Acetabularia-speciﬁc codon usage (translated as Gln) Conversion of TAA to CAA was performed ... pVC51/pVC51N for AACEVAPD5 and pVC74/pVC74N for AACEVAPD6 ) [7,8] were subjected to PCR with primer sets of AP2 and adaptor for AACEVAPD1, AP2 and adaptor for AACEVAPD2, AP2 both at 50 and 30 ends for AACEVAPD3–6,...

8
391
0

To Cut or Not to Cut? That is the (Central Bank’s) Question In Search of the Neutral Interest Rate in Latin America pdf

Ngày tải lên : 15/03/2014, 14:20

... are based on the official central bank’s inflation targets since 2000 in the event the IT framework was adopted afterwards, the average of the actual annual inflation rate in the sample is taken ... inertia due to the indexation of financial contracts to the overnight interest rate (World Bank, 2006) While this indexation has maintained financial intermediation in Reais, it has created a ... his torical data 12-m onth ahead inflation expectations 2012 April WEO Data was interpolated by obtaining the 12-month ahead inflation projection of the corres ponding year Inflation target National...

48
504
0

Báo cáo khoa học: A pathway through interferon-c is the main pathway for induction of nitric oxide upon stimulation with bacterial lipopolysaccharide in mouse peritoneal cells pot

Ngày tải lên : 17/03/2014, 10:20

... morphological criteria The murine macrophage cell line RAW264.7, originally from the American Type Culture Collection (Manassas, VA, USA) and maintained in our laboratory, was also used For cell ... nitrite as the standard in each assay Production of IFN-c and IL-12p70 (active form) was determined as the amount in the culture supernatant obtained 24 h after stimulation The concentration of each ... cytokine was measured using a speciﬁc sandwich ELISA, according to the manufacturer’s instructions (Endogen) using matched antibody pairs A 96-well EIA/RIA plate (Corning Inc.), coated with a coating...

10
395
0

báo cáo hóa học:" Higher percentage of CD133+ cells is associated with poor prognosis in colon carcinoma patients with stage IIIB" pptx

Ngày tải lên : 18/06/2014, 15:20

... cells in the cancer nest; (C) and (D): the staining of CD133 on the luminal surface and the basal surface of cancer cells; (E): the staining of CD133 on budding cancer nest; (F): the staining of ... stage IIIB colon carcinoma patients by clinicopathological parameters with univariate and multivariate analysis Clinicopaothological characteristics N (n = 104) 5-year survival Kaplan-Meier analysis ... 5-year survival rate was 64.4% Kaplan-Meier analysis revealed that the percentage of CD133+ cells in cancer nests and the invasive depth of primary mass were prognostic The 5-year survival rate among...

8
550
0

Báo cáo sinh học: " The Israeli strain IS-98-ST1 of West Nile virus as viral model for West Nile encephalitis in the Old World" pdf

Ngày tải lên : 18/06/2014, 22:20

... passage through the blood-brain barrier However, the fact that infected neural cells are detected in the olfactory bulb after intra-nasal inoculation suggests that an intraneural transport of ... serum and a FITC-conjugated secondary antibody, green staining) and neuronal specific enolase (using a rabbit polyclonal antiserum and an anti-rabbit polyclonal antibody made in goat conjugated ... strain IS- 98-ST1 is suitable as viral model for West Nile encephalitis in the Old World The Israeli strain IS- 98-ST1 that caused the epizootic in Israel in 1998, was found to be highly neuroinvasive...

5
403
0

báo cáo hóa học:" HIV prevention is not enough: child survival in the context of prevention of mother to child HIV transmission" potx

Ngày tải lên : 20/06/2014, 08:20

... breastfeeding is best for all infants, regardless of their HIV status, and is associated with decreased infant mortality [34] Another advantage of lactation counselling is that simple and consistent ... community in South Africa in 2001, resulting in the establishment of a national PMTCT programme But investigators in this field have also been targets of attack and have borne the brunt of unfair accusations ... rural Uganda, a special pre-packaged formulation of the infant nevirapine dose was used to ensure that women who delivered at home could give their infants the nevirapine [13] In Zambia, establishment...

10
569
0

G-13 Glossary Required in the Statement of Operations (q.v.) by the Health Care Guide. reporting doc

Ngày tải lên : 21/06/2014, 04:20

... Accounting and Reporting Manual for Higher Education (NACUBO), 337, 353 Financial Accounting Foundation (FAF), Financial Accounting Standards Board (FASB), Accounting for Certain Investments of Not -for- Profit ... Impairment of Capital Assets and for Insurance Recoveries (GASB Statement 42), 251 Accounting and Financial Reporting for Nonexchange Transactions (GASB Statement 33), 230, 280 Accounting and Financial ... statistical section One of the three major parts of the Comprehensive Annual Financial Report (CAFR) (q.v.), listing schedules that assist users in evaluating the financial condition of a government and...

19
413
0

Everyone Is a Customer - A Proven Method for Measuring the Value of Every Relationship in the Era of Collaborative Business pot

Ngày tải lên : 28/06/2014, 08:20

... such as Pakistan that previously supported the Taliban Fearing instability, Pakistan offered information about, and access to, the Taliban and Afghanistan to the United States In return, the United ... equated these two major developments with declining sales, plummeting valuations, and soaring layoffs Others have a sense of the association and are trying to see their way clear Not all of the economic ... relationship is trying to satisfy and how the relationship should go about satisfying them Then, in the actual process of conducting the relationship, the assumptions are tested against reality If the...

236
507
0

Everyone Is a Customer - A Proven Method for Measuring the Value of Every Relationship in the Era of Collaborative Business pdf

Ngày tải lên : 28/06/2014, 22:20

... such as Pakistan that previously supported the Taliban Fearing instability, Pakistan offered information about, and access to, the Taliban and Afghanistan to the United States In return, the United ... equated these two major developments with declining sales, plummeting valuations, and soaring layoffs Others have a sense of the association and are trying to see their way clear Not all of the economic ... relationship is trying to satisfy and how the relationship should go about satisfying them Then, in the actual process of conducting the relationship, the assumptions are tested against reality If the...

236
617
0