vitamin e and c for skin
Quantification of vitamin e and ç oryzanol components in RiceGermandBran
Ngày tải lên :
15/03/2014, 15:33
... temperature until ethanol
and methanol were removed followed by drying in a freeze-dryer. The
dry extracts (extractable phytochemicals) represented 24.8% of the rice
germ and 16.3% of the rice bran, respectively. ... mode
(Figure 3). The prominent negative and positive molecular ion
species make ESI-MS a valuable analytical method for
detecting vitamin E compounds and determining their structures,
especially when ... respectively. The extract was
partitioned between water (200 mL) and dichloromethane 3 times (200
mL ì 3). The aqueous layer and combined dichloromethane extract
were rotary evaporated under reduced...
- 6
- 649
- 1
Tài liệu Draining for Profit, and Draining for Health by George E. Waring docx
Ngày tải lên :
17/02/2014, 14:20
... the spaces between them, being filled
with water, no air can enter, whereby the chemical processes by
which the inert minerals, and the roots and manure, in the soil
are prepared for the use ... before draining; these, with their excretions,
decompose on removal of the crop, and are acted on by the
alternating air and water, which also decompose and change, in
a degree, the inorganic ... that there are two
distinct classes of pores,—first, the large ones, which exist
between the particles of soil, and second, the very minute
ones, which occur in the particles themselves; and you...
- 298
- 444
- 0
Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx
Ngày tải lên :
18/02/2014, 17:20
... and Chemical Sciences, The University of Western Australia, Crawley, Australia
2 Department of Pharmaceutical Sciences, College of Pharmacy, University of Tennessee Health Science Center, Memphis, ... Department of Pathology and Laboratory Medicine and the Center for Cancer Research, University of Tennessee Health Science Center,
Memphis, TN, USA
5 Department of Pharmacology and the Center ... Center for Cancer Research, University of Tennessee, Health Science Center, Memphis, TN, USA
Cytochrome P450scc (CYP11A1) catalyzes the first
enzymatic step in steroid synthesis: the cleavage of the
side...
- 12
- 704
- 0
Tài liệu Báo cáo khoa học: Gas6 and protein S Vitamin K-dependent ligands for the Axl receptor tyrosine kinase subfamily pptx
Ngày tải lên :
19/02/2014, 05:20
... proteolytic cleavage has
been detected in conditioned medium of various cell
lines [62,66]. A mouse Axl ectodomain was detected in
tumour cell and dendritic cell medium and in serum,
and the disintegrin-like ... confer adhe-
sive properties on cells. This may occur through lig-
and- independent homophilic interactions between
receptor molecules on neighbouring cells, and the
structural prerequisites for ... adhesion may contribute to the
increased metastasic properties of tumour cells [64].
Therefore, when Axl is overexpressed in cancer, its
mediation of increased cell–cell adhesion may be at
least...
- 14
- 600
- 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt
Ngày tải lên :
06/03/2014, 01:20
... Program
CI Confidence interval
CIA Enhanced chemiluminescence
CMS Centers for Medicare and Medicaid Services
DIS Disease intervention specialist
DTaP Diptheria and tetanus toxoids and acellular ... develop a vaccine for hepatitis C, which could substantially
enhance hepatitis C prevention efforts. The committee recognizes the need for a safe, effective,
and affordable hepatitis C vaccine ... receive appropriate medical management.
x 5-2. The Centers for Disease Control and Prevention, in conjunction with other federal
agencies and state agencies, should provide resources for the...
- 191
- 457
- 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc
Ngày tải lên :
06/03/2014, 01:20
... of Sciences, the National Academy of Engineering, and the Institute
of Medicine. The members of the committee responsible for the report were chosen for their
special competences and with regard ...
substantially enhance hepatitis C prevention efforts. The committee recog-
nizes the need for a safe, effective, and affordable hepatitis C vaccine and
offers the following recommendation:
Recommendation ... C
http://www.nap.edu/catalog/12793.html
vii
Reviewers
T
his report has been reviewed in draft form by persons chosen for
their diverse perspectives and technical expertise, in accordance with
procedures approved by the National Research...
- 253
- 369
- 0
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf
Ngày tải lên :
07/03/2014, 09:20
... fluoro-
phore MOCAc is quenched by the chromophoric resi-
due Dnp. After cleavage of the peptide, the quenching
efficiency is decreased, resulting in an increase in
fluorescence. The activity determined ... [14]. CatE-deficient mice are
found to develop atopic dermatitis-like skin lesions
[15]. It was reported recently that CatE-deficient mice
show increased susceptibility to bacterial infection
associated ... immobilized on CH-activated Sepharose at 4 C over-
night. With this method, the measured increase in
fluorescence intensity is exclusively caused by CatD. The
difference between total aspartic proteinase...
- 12
- 645
- 0
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
Ngày tải lên :
07/03/2014, 15:20
... Natural Science, Charles University, Prague, the Czech Republic;
3
Institute of Molecular
Genetics, Academy of Sciences of the Czech Republic, Prague, the Czech Republic;
4
Guilford Pharmaceuticals ... sequence.
The clones were used to generate stably transfected Dro-
sophila Schneider’s cells, and the expression and carboxy-
peptidase activities of the individual protein products were
determined. ... C
ATTCTCGAGTCATTAGGCTACTTCACTCAAAG
274/587 AAACTCGAGAGATCTAAATCCTCCAATGAAGC 30 s/94 C; 1 min/56 C; 3 min/72 C
CACCTCGAGTTATTATAGCTCAAACACCATCC
44/587 AAACTCGAGAGATCTAAATCCTCCAATGAAGC 30 s/94 C; 1 min/56 C; 3 min/72 C
CACCTCGAGTTATTATAGCTCAAACACCATCC
44/750_V5-His...
- 9
- 414
- 0
Báo cáo khoa học: A DmpA-homologous protein from Pseudomonas sp. is a dipeptidase specific for b-alanyl dipeptides Hidenobu Komeda and Yasuhisa Asano docx
Ngày tải lên :
07/03/2014, 21:20
... significant
homology between the amino acid sequences deduced
from pepV of L. delbrueckii and from bapA. BapA is
therefore the first example of a highly purified and
characterized enzyme speci c for ... the 27 and 13 kDa peptides, respectively.
These sequences corresponded to residues 1–5 and
239–243 of the deduced amino acid sequence of BapA.
This result clearly indicated that the mature enzyme
with ... d-stereoselective enzy-
mes exhibiting strict d-stereoselectivity, DmpA shows
a peculiar substrate specificity acting on Ala-p-NA,
alaninamide and alanine methylester with a preference
for the d-configuration,...
- 10
- 406
- 0
An e-Health System for the Elderly (Butler Project): A Pilot Study on Acceptance and Satisfaction pot
Ngày tải lên :
14/03/2014, 20:20
... After-
wards, the real time was recorded in order to calculate the
difference.
Procedure
Butler has been previously tested for usability.
27
After
correcting the problems encountered in these ... life
and are intended to evoke speci c positive memories
from each period. The professional records various mem-
ories that the user generates in each therapy session.
The elements already covered in ... Schwartz
7
dem-
onstrated the effectiveness of interactive CDs for memory
training in older people. Furthermore, Franco et al.
8
devel-
oped and successfully implemented a computer system called
GRADIOR...
- 8
- 733
- 0
HTML5 FOR DUMmIES‰ Q U I C K R E F E R E N C E doc
Ngày tải lên :
15/03/2014, 19:20
... the value
attribute. Any text you place in the value will become the default value of
the form.
The text element will place a small box on the screen. When the user selects the
box, the cursor ... Publisher
Andy Cummings, Vice President and Publisher
Mary Bednarek, Executive Acquisitions Director
Mary C. Corder, Editorial Director
Publishing for Consumer Dummies
Diane Graves Steele, Vice President ... movement
was never realized. Creating valid XHTML documents proved difficult enough
that very few developers tried. Browsers rendered inaccurate XHTML code
decently (if not perfectly). In fact,...
- 228
- 586
- 0
Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70 potx
Ngày tải lên :
17/03/2014, 10:20
... 5Â-ACAAGGG
TAGACCAAACACCAAGAACAGCAACAAAAGAG
ACGGGCGAATCACTGACCATCAACgccGTCCTGA
GAGAT-3Â) and N8518 (Reverse: 5Â-TTTCACGGTTAA
TGCGGTGCCAGCTCCCCAACTGTAATAAATACC
AGACAAATTATATGCTCCaacCCTATACGTGCCA
CTG-3Â); ... ()
GTCTCGCGGCCCAGCCGGCCATGGCCGCAAGGGTGGACCAAACACC N-terminus ẳ ARVDQTP
5Â Amplication 8408 ()
GTCTCGCGGCCCAGCCGGCCATGGCCGCATGGGTAGACCAAACACC N-terminus ẳ AWVDQTP
3Â Amplication 8404 ()
CACGTTATCTGCGGCCGCTTTCACGGTTAATGCGGTGCC ... antisense primer ().
Oligonucleotide Number Sequence (5Â 3Â) Features
5Â Amplication 8406 ()
GTCTCGCGGCCCAGCCGGCCATGGCCACAAGGGTAGACCAAACACC N-terminus ẳ TRVDQTP
5Â Amplication 8407 ()
GTCTCGCGGCCCAGCCGGCCATGGCCGCAAGGGTGGACCAAACACC...
- 12
- 522
- 0
Báo cáo Y học: Expression and characterization of recombinant vitamin K-dependent c-glutamyl carboxylase from an invertebrate, Conus textile doc
Ngày tải lên :
17/03/2014, 10:20
... or sequencing artefacts in either of
the clones.
To prove that the cloned cDNA encoded a vitamin K-
dependent carboxylase, we expressed this coding sequence
in vertebrate and invertebrate cells. ... vitamin
K-dependent carboxylase, and identified structural and
functional similarities and differences between invertebrate
and verterbrate vitamin K-dependent carboxylases. We
demonstrate amino-acid sequence ... The difference in the
expression level in the two systems is related to the efficiency
of carboxylase expression in these systems. The speci c
carboxylase activity of the Conus carboxylase is very...
- 11
- 537
- 0
c++ for engineers and scientists
Ngày tải lên :
19/03/2014, 14:07
... 40 new engineering and scientific exercises that incorporate the
fields of electrical engineering, mechanical engineering thermodynamics, structural
engineering, numerical applications, physics, ... example of acceptable pseudocode
for describing the steps to compute the average of three numbers:
Input the three numbers into the computer’s memory
Calculate the average by adding the numbers ... analysis for selecting
correct conversion factors, consider converting days to seconds. You can determine the correct
form of each conversion factor easily by including the units with each conversion...
- 849
- 876
- 3
Jim ledin embedded control systems in c and c++ an introduction for software developers using MATLAB 2004
Ngày tải lên :
19/03/2014, 14:09
... system performance is
achieved, you are done. If excessive overshoot and oscillation occur before acceptable response
time is achieved, you will need to add a derivative term. If the steady-state ...
1.7 Performance Specifications
One of the first steps in the control system development process is the definition of a suitable set of system
performance specifications. Performance specifications ... automobile:
The cruise control manipulates the throttle setting so that the vehicle speed tracks the commanded speed set by the
driver.
In years past, mechanical or electrical hardware components performed...
- 268
- 2.4K
- 0
