0

virtual and augmented reality a new approach to aid users of myoelectric prostheses

capital structure and firm performance a new approach to testing agency theory and an application to the banking industry

capital structure and firm performance a new approach to testing agency theory and an application to the banking industry

Quản trị kinh doanh

... efficiency, and ECAPi is the ratio of equity capital to gross total assets The use of ECAPi as an inverse measure of leverage is standard in banking research in part because of the regulatory attention ... vector p; three fixed netputs z (off-balance-sheet activity, physical capital, financial equity capital); and an environmental variable STNPL (the ratio of total nonperforming loans to total loans ... problem in that many of these additional banks are owner managed rather than professionally managed, and therefore not provide a good laboratory for testing the agency costs of the separation of ownership...
  • 38
  • 561
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf

Báo cáo khoa học

... early as ill-formed In Figure we give an illustration of the behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra ... here, although designed and implemented for Warlpiri, is intended to be a general approach to morphological parsing A number of extensions can easily be made and a number of design improvements are ... system as a partial but general theory of morphological processing, and the work we have done on Warlpiri as a particular instantiation of this general model $ Extensions and Improvements to the...
  • 8
  • 522
  • 0
Báo cáo y học:

Báo cáo y học: " Control of allergic rhinitis and asthma test – a formal approach to the development of a measuring tool" ppt

Báo cáo khoa học

... meeting of the Formal Consensus Process Ana Arrobas Ana Todo-Bom Ângela Gaspar Aurora Carvalho Carlos Alves Carlos Lopes Fernando Calvário Authors' contributions LNS participated in data collection, ... Passalacqua G, Venturi S, Braido F, Bonini S, Majani G, Canonica GW: Rhinasthma: A new specific QoL questionnaire for patients with rhinitis and asthma Allergy: European Journal of Allergy and ... Respiratory Research 2009, 10:52 Introduction Allergic rhinitis and asthma (ARA) are inflammatory diseases and are often associated The lack of control of these diseases is responsible for a significant...
  • 9
  • 370
  • 0
Báo cáo y học:

Báo cáo y học: "Nebulised heparin: a new approach to the treatment of acute lung injury" pdf

Báo cáo khoa học

... Critical Care Vol 12 No Suter The translation of a potentially beneficial effect of inhaled heparin in experimental models of ALI to clinical practice has not yet been achieved; important additional ... heparin administration as rapidly as necessary? How can dosage of the drug be titrated to achieve maximal local effects without the risk of systemic complications? What is the adequate duration ... duration of this therapy? Does the underlying cause of ALI make any difference with regard to this approach? Ultimately, randomized controlled trials will provide the data necessary to determine...
  • 2
  • 350
  • 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

Khoa học xã hội

... central concern of applied linguistic As a matter of fact, C .A has had much to offer not only to practical language but also to translation theory, the description of particular language, language ... semantic and syntactic functions of English adjectives Chapter III is a study to a new approach to semantic and syntactic functions of English adjectives Chapter IV is to make a contrastive analysis ... up to now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central...
  • 44
  • 1,747
  • 7
Partnering: A New Approach to Sexual and Reproductive Health doc

Partnering: A New Approach to Sexual and Reproductive Health doc

Sức khỏe phụ nữ

... Gender-Based Approach , Sexual Health Exchange 1998, no 2, pp 3–6 83 T Valdés and J Olvarríra, eds, “Masculinidades y equidad de genéro en America Latina”  21 Partnering: A New Approach To Sexual And ... International and IPPF/WHR, “Male Participation in Sexual and Reproductive Health: New Paradigms” (Symposium Report, Oaxaca, Mexico, October 1998), p  17 Partnering: A New Approach To Sexual And ... education and services for prenatal care, safe delivery and postnatal care, especially breastfeeding and infant and women’s health care; prevention and appropriate treatment of infertility; abortion as...
  • 196
  • 505
  • 0
INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx

INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx

Tự động hóa

... Tuula, Susanna, Katri, and Juha as an integral part of my intellectual welfare I have had the privilege to be able to attend several international conferences, to meet new colleagues, and to see some ... regard to paper manufacturing and the end-uses of paper products as well as in paper recycling Almost as long as man has made paper, first by hand and then industrially, different additives have ... phenomena in paper, and to the properties of paper as a material In this thesis of basic research, an approach derived primarily from adsorption, adhesion, and polymer sciences was applied to study...
  • 89
  • 701
  • 1
Báo cáo toán học:

Báo cáo toán học: " A new approach to investigate the interactions between sediment transport and ecotoxicological processes during flood events" ppt

Toán học

... kg−1) A total amount of about 700 kg artificial sediment was prepared for the experiments in the annular flume and half of the sediment was spiked with the abovedescribed PAHs This approach was ... environmental parameters) instrumental chemical analyses ranged from 52% to 74% After introducing sediment into the annular flume, it was carefully overlaid by water and consolidated for days according ... one of the major challenges of this proofof-concept study The characterization of sedimentological parameters resulted in critical bed shear stresses and temporal variations of suspended particulate...
  • 5
  • 435
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article A New Approach to q-Bernoulli Numbers and q-Bernoulli Polynomials Related to q-Bernstein Polynomials" pdf

Hóa học - Dầu khí

... polynomials,” in ¸ ¨ Proceedings of the 8th International Conference of Numerical Analysis and Applied Mathematics (ICNAAM ’10), AIP, Rhodes, Greece, March 2010 M Acıkgoz and Y Simsek, A new generating ... polynomials,” in Proceedings of the ¸ ¨ 8th International Conference of Numerical Analysis and Applied Mathematics (ICNAAM ’10), AIP, Rhodes, Greece, March 2010 L Carlitz, “q-Bernoulli numbers and ... Mathematical Physics, vol 10, no 1, pp 91–98, 2003 12 T Kim, “Power series and asymptotic series associated with the q-analog of the two-variable p-adic L-function,” Russian Journal of Mathematical...
  • 9
  • 442
  • 0
Sectors and Styles - A New Approach to Outperforming the Market docx

Sectors and Styles - A New Approach to Outperforming the Market docx

Quản trị kinh doanh

... Emily and Len Brizzi, Gino and Donna Albertario, Vahan Janjigian, Annette and Clint Welch, Don Horenstein, Mark Wachs, John Mihale, Mark and Roberta Aaronson, Rocco Papandrea, Milan Miletic, Maris ... disposal the essential communications and analytical tools to capture that data and incorporate it into a financial and valuation model that forms the basis for a successful investment strategy ... the challenges were overcome thanks to those whom I am proud to call friends and colleagues Many thanks go to Jason and Jane Welsch, Bharath Chandar, Joseph Roccasalvo, George and Andrea Fulop,...
  • 275
  • 706
  • 0
A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model

A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model

Tổng hợp

... fraction of original area after wounding The original wounded area at day is defined as 100 percent original area, the areas at day 3, and are calculated as the percentage of the original area ... BX51) at 400X magnification - 42 - Chapter Materials and Methods Statistical analysis Data are presented as mean ± SE Statistical significance was analyzed by variance (ANOVA), a Tukey test was applied ... implicated in the pathogenesis of diseases as diverse as hypertension, asthma, septic shock and dementia; and as a potential marker of clinical diseases, that may prove amenable to therapeutic manipulation...
  • 80
  • 424
  • 0
A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids  the  rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene

A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids the rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene

Kỹ năng đọc tiếng Anh

... perruthenate (TPAP)–NMO21 gave the aldehyde 21 Addition of lithium tert-butyl acetate22 (generated from tert-butyl acetate and LDA in THF at À78 °C) to 21 afforded an adduct that was desilylated ... Danishefsky4b,d and Mehta14 have shown that methylation of similar a, b-unsaturated ketones introduces the methyl group in a trans-orientation with respect to the angular methyl group The allyl and oxo ... conformational flexibility of this compound. 2a, 3a No spectrum of the natural compound was available for a direct comparison To complete the formal synthesis of guanacastepene A (1), diol 24 was dissolved...
  • 3
  • 547
  • 0
The Republic of Beliefs A New Approach to Law and Economics

The Republic of Beliefs A New Approach to Law and Economics

Tổng hợp

... a special mode to carry out their altered role mechanically, at the moment of adopting a new law (World Bank, 12 approach to law and economics, and it has sullied a lot of our analysis and hurt ... Bhattacharya and Mishra (1989), Basu, Basu and Cordella (2015) For some recent analysis of this problem of bribery and the motivation of the law enforcer, see Abbink, Dasgupta, Gangadharan and Jain ... similar to a monarch announcing a new law 46 12 Concluding Remarks The focus of this paper was law and economics, but it has a larger ambition Much of the paper argued that the traditional approach...
  • 55
  • 514
  • 0
A New Approach to Quantum Theory

A New Approach to Quantum Theory

Khoa học tự nhiên

... However, Feynman soon learned that there was a great obstacle to this delayed action-at -a- distance theory: namely, if a radiating electron, say in an atom or an antenna, were not acted upon at all by ... The Calculation of Matrix Elements in the Language of a Lagrangian 32 The Equations of Motion in Lagrangian Form 34 Translation to the Ordinary Notation of Quantum Mechanics 39 The Generalization ... principle of least action of classical dynamics Applying this method to the particular example of particles interacting through the intermediary of classical harmonic oscillators (an analogue of the...
  • 142
  • 574
  • 0
Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf

Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf

Cao đẳng - Đại học

... Defense, and Homeland Security; the Federal Aviation Administrations (FAA); the National Aeronautics and Space Administration (NASA); and the White House Office of Science and Technology to plan the ... a BA from California State College at Fullerton, an MA from the University of Washington, and a PhD from Oregon State University He has taught a variety of public and private administration and ... attempting to impose a transformational change into their organizations (Slavin and Woodard 2006, 23): We close with a caution and a challenge Transformation has many elements, and the failure of any...
  • 288
  • 2,415
  • 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học

... ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R ... name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT ... used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards are indicated at the left and right of the agarose gels (B) Visualization and separation of high molecular mass...
  • 11
  • 731
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A new Approach to Improving Multilingual Summarization using a Genetic Algorithm" pptx

Báo cáo khoa học

... of Language Resources and Evaluation We are grateful to Michael Elhadad and Galina Volk from Ben-Gurion University for providing the ROUGE toolkit adapted to the Hebrew alphabet, and to Slava ... using a GA to find an optimal set of values for the outcomes of 14 indicators and apply the optimal combination of values from data on one text to a different text With such approach, training may ... often, because then GA will in fact change to random search Our mutation operator includes a probability (3%) that an arbitrary weight in a vector will be changed by a uniformly randomized factor in...
  • 10
  • 598
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Semantic Analysis of Japanese Noun Phrases: A New Approach to Dictionary-Based Understanding" doc

Báo cáo khoa học

... and a semantic role of a head word All definition sentences in RSK were analyzed by JUMAN, a Japanese morphological analyzer, and KNP, a Japanese syntactic and case analyzer (Kurohashi and Nagao, ... aspects of meaning construction in natural language The MIT Press Charles J Fillmore 1968 The case for case Holt, Rinehart and Winston, New York Satoru Ikehara, Masahiro Miyazaki, Satoshi Shirai, Akio ... Meeting of ACL, pages 123-130, Stanford, California Eiichiro Sumita, Hitoshi Iida, and Hideo Kohyama 1990 Translating with examples: A new approach to machine translation In Proceedings of the...
  • 8
  • 553
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A New Approach to the Mechanical Syntactic Analysis of Russian" ppt

Báo cáo khoa học

... suitable external media for its storage and retrieval Of far greater concern is the fact that we are not fully aware of the mental processes involved in the performance of the translation task ... possible, starters of main clauses, (4) actual, or possible, starters of subordinate clauses, (5) actual, or possible, predicates for each clause, and (6) actual, or possible, phrase starters As a result ... (v) to indicate whether the predicate of the clause has or has not occurred, Its phrase number (P), and A Backward Flag (b) to indicate a particular manner in which the string is to be handled...
  • 18
  • 701
  • 0

Xem thêm