verbs simply use the ed form of the verb in a positive sentence
The Art of Grief The Use of Expressive Arts in a Grief Support Group pptx
Ngày tải lên :
29/03/2014, 04:20
... meet the needs of the members and the facilitators is the initial planning, organization, and setting up of the group This initial stage can easily be bypassed in the interests of time and the ... Grief and the Sacred Art of Ritual Janet Shaw Rogers 129 Section III Alternative Art Forms, Programs, and Stories of Art and Healing Chapter 14 The Painters Deborah Koff-Chapin, Carol McIntyre, and ... relationship The type of relationship The role the deceased played in the bereaved’s life Any unfinished business between the deceased and the bereaved Secondary losses arising from the death, such as finances...
- 324
- 639
- 0
Báo cáo y học: "Use of intravitreal bevacizumab in a patient with a Von Hippel-Lindau-associated retinal haemangioblastoma of the optic nerve head: a case report" docx
Ngày tải lên :
11/08/2014, 23:21
... three intravitreal bevacizumab injections in a patient with VHL and a peripapillary retinal haemangioblastoma Treatment with ranibizumab in patients early in the course of their disease, who have ... procedure and drafted the manuscript Both authors read and approved the final manuscript Consent Written informed consent was obtained from the patient for publication of this case report and accompanying ... laser and transpupillary thermotherapy However, because of previously reduced vision with laser photocoagulation the patient declined further laser therapy Treatment with intravitreal bevacizumab...
- 4
- 263
- 0
Báo cáo y học: " Exploring the optimum approach to the use of CT densitometry in a randomised placebo-controlled study of augmentation therapy in alpha 1-antitrypsin deficiency" pptx
Ngày tải lên :
12/08/2014, 14:20
... EXACTLE trial was designed to explore the use of CT densitometry as an outcome measure for the assessment of plasma AAT augmentation therapy in individuals with AATD The analytical approach, and ... data clearly indicate a graded response to therapeutic augmentation of AAT The graded therapeutic effect that was most evident in the basal region may indicate that the progression of panlobular ... of Talecris and participated in the design of the study, in the collection, analysis and interpretation of data (CD was the statistician for the study), in the writing of the manuscript and in...
- 10
- 439
- 0
Báo cáo y học: "The Nordic Maintenance Care Program – An interview study on the use of maintenance care in a selected group of Danish chiropractors" pdf
Ngày tải lên :
13/08/2014, 14:20
... and three mentioned an interval of months They also mentioned that the timing of appointments would vary with the needs of the patient Duration of maintenance care program Aim of the maintenance ... standard management programs Rather, their responses indicated that maintenance care can be used for any type of low back pain with the intent of improving spinal function in order to avoid a ... was quantified and entered into a table Proportion of patients treated with maintenance care At the interview, the participants were asked to identify the number of patients receiving maintenance...
- 7
- 420
- 0
Báo cáo sinh học: "Impact of the use of cryobank samples in a selected cattle breed: a simulation study" potx
Ngày tải lên :
14/08/2014, 13:21
... pressures and have rates of inbreeding greater than the desired values [7] In these cases, the use of stored semen from male ancestors has seldom been investigated, although breeding organisations ... be interested in doing so For instance, in the dairy cattle breed Abondance (a local selected breed in the French Northern Alps), the semen of a bull born in 1977 (called Naif), which was rarely ... cattle has led to an undesirable increase in inbreeding, as well as to the deterioration of some functional traits which are indirectly selected Semen stored in a cryobank may be a useful way...
- 28
- 245
- 0
Residence, habitat use, and movement patterns of atlantic tripletail in the ossabaw sound estuary, georgia
Ngày tải lên :
04/09/2015, 17:10
... week, involved systematically searching the study area using a search interval of 300–400 m At each stop, the omnidirectional hydrophone was lowered into the water If a tagged fish was detected, the ... directional hydrophone was lowered into the water, and triangulation and homing were used until a reading of 95 dB or above was detected at a gain of 12 or less (∼4 m from the fish) A GPS unit was used ... Spatial Habitat Use The spatial distribution of detections recorded over the years of the study revealed that most of the habitat use was focused within the OSE’s North Channel from the mouth of...
- 13
- 494
- 0
Use the words in capitals to form a word that fits into the space next to it
Ngày tải lên :
29/08/2016, 18:07
... With the real plan, the rate of in Brazil has fallen (INFLATE) 66 She looked at him , and started to cry (HAPPY) 67 The party was , everything went wrong (DISASTER) ... 26.We had to get special to leave early (PERMIT) 27.As the best man, he had to make a at the wedding (SPEAK 28 He was sitting in his seat on the train (COMFORT) ... There were only a of people at the match (HAND) 42 She arrived late at work because she had (SLEEP) 43 The road was too narrow, so they had to it (WIDE) 44 He was...
- 3
- 653
- 1
Tài liệu Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold III; Planar domains " doc
Ngày tải lên :
14/02/2014, 17:20
... from the boundary Here small means contained in a small ball 527 PLANAR DOMAINS A “pair of pants” (in bold) Graphical annuli (dotted) separate the “pairs of pants” Figure 4: Decomposing the Riemann ... that all embedded stable minimal surfaces with small interior boundaries are graphical away from the boundary Here small means contained in a small ball in R3 (and not that the interior boundary ... Solving a Plateau problem gives a stable graphical annulus separating the boundary components of an embedded minimal annulus Stability of Γ in Theorem 0.3 is used in two ways: To get a pointwise...
- 51
- 463
- 0
Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt
Ngày tải lên :
21/02/2014, 20:20
... expands, the correct denotational relationship is maintained by expanding the image in the table using the ~-expression, and then finding the corresponding element in the model If the element in the ... that was the denotation of the h-expression was not expanded in the same way as the image in this table, a new element corresponding to the expanded image is added to the model This table allows ... to a model has been augmented with a table that contains each ~-expression and the ima6e of its denotation in the current stage of the dynamic model When the domain of the ~-expression expands,...
- 3
- 394
- 0
THE CONSTITUTION OF LAW Legality in a Time of Emergency potx
Ngày tải lên :
07/03/2014, 02:20
... saw the crux of the case in a moment, and informed me that the same point had been settled in a case decided in the Privy Council on an appeal from Pondoland I asked the date, and he gave me the ... create a variety of legal black holes, situations in which individuals suspected of being threats to national security are detained indefinitely In the United Kingdom, they were detained because, ... of my examples are drawn are the United Kingdom, Canada, and Australia Together they present a fertile ground for testing my claims because, until quite recently, Canada and Australia had what...
- 268
- 661
- 0
THE CONSTITUTION OF LAW Legality in a Time of Emergency docx
Ngày tải lên :
07/03/2014, 02:20
... saw the crux of the case in a moment, and informed me that the same point had been settled in a case decided in the Privy Council on an appeal from Pondoland I asked the date, and he gave me the ... create a variety of legal black holes, situations in which individuals suspected of being threats to national security are detained indefinitely In the United Kingdom, they were detained because, ... of my examples are drawn are the United Kingdom, Canada, and Australia Together they present a fertile ground for testing my claims because, until quite recently, Canada and Australia had what...
- 268
- 1.1K
- 0
Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf
Ngày tải lên :
08/03/2014, 23:20
... AACEVAPD1 AACEVAPD3 AACEVAPD2 AACEVAPD5 AACEVAPD4 AACEVAPD6 Vma3p Vma11p Vma16p 100 97 80 80 80 80 50 50 32 100 94 93 93 54 51 28 AACEVAPD5 AACEVAPD2 AACEVAPD3 AACEVAPD1 Table Alignments of the ... preparation of recombinants in yeast expression vector In the case of AACEVAPD1, and 6, TAA is used as an Acetabularia-specific codon usage (translated as Gln) Conversion of TAA to CAA was performed by ... and a (VO portion) of the yeast vacuolar membrane H1-ATPase in vacuolar-membraneenriched fractions of the transformants of AACEVAPD1–6 The vacuolar-membrane-enriched fractions were prepared as...
- 8
- 391
- 0
Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold I; Estimates off the axis for disks " doc
Ngày tải lên :
14/03/2014, 22:20
... π In either case the separation w = π A multi-valued minimal graph is a multi-valued graph of a function u satisfying the minimal surface equation GRAPHICAL OFF THE AXIS 29 x3 -axis One half ... domains, Ann of Math., to appear; math.AP/0210141 [CM6] ——— , The space of embedded minimal surfaces of fixed genus in a 3-manifold IV; Locally simply connected, Ann of Math., to appear; math.AP/0210119 ... the lemma The next lemma shows that if an embedded minimal disk Σ in the intersection of a ball with a thin slab is not graphical near the center, then it contains a curve γ coming close to the...
- 43
- 410
- 0
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt
Ngày tải lên :
16/03/2014, 16:20
... AATTCTCGAGTGCTGCTGCTGCGAATGCTGC GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC ... C3K -A7 K HC-K 7A MG3K6S MG3K6S7K T3 B1 ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC ... GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC GCCGCTCGAGCCTGTAGCCCATGTT AATTCTCGAGTGCTGCTGCTGCCGATGCTGC AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC AATTCTCGAGTGCTGCTGCTGCGAATGCTGC...
- 12
- 512
- 0
modeling of the conduction in a wo3 thin film as ozone sensor
Ngày tải lên :
20/03/2014, 13:04
... combined action of the two mixed gases is finally studied at the end of this article In each case, the interaction between the semiconductor material and the gases is approached by means of the adsorption ... Among the various intermediate parameters, the more interesting are the total and ionized covering rates of the grains due to the atmosphere interaction, the electrical potential induced by the ... polycrystalline layer made up of grains which have a great disparity of shape and size In this work, the grains are supposed to be quasi-spherical, identical in size, and single-crystal They are jointed,...
- 8
- 662
- 0
Gynecological Malignancies: Epidemiological Characteristics of the Patients in a Tertiary Care Hospital in India doc
Ngày tải lên :
22/03/2014, 11:20
... that was with mean of 15.4 years The mean ages at marriage for treated All of them had stated about history of genital ovarian cancer and endometrial cancer cases were 17.0 ulcer of their husbands ... endometrial carcinoma 56.0 years A study done in Larkana, Pakistan (Siyal et al., 1999) had reported that the average age of the patients with gynecological cancer was 46.5 years and the peak age ... ovarian malignancy Mogren et al (2001) in their study conducted in Sweden commented that increasing maternal age at first birth was associated with an increasing risk of endometrial and ovarian...
- 8
- 686
- 0