using the dynamics of a person context system to describe children s understanding of air pressu
Báo cáo hóa học: " Beyond satisfaction: Using the Dynamics of Care assessment to better understand patients'''' experiences in care" pptx
... the area of Specialty and Inpatient Hospital Care (see Table 3) Overview of analysis of the Dynamics of Care We conducted a series of analyses on the Dynamics of Care assessment to better understand ... representative sample of clients' concerns for further discussion in the Dynamics of Care assessment, we first asked respondents to rate their satisfaction with services available to them in each ... identified at the three month time point (see discussion of measure below) The Dynamics of Care assessment The Dynamics of Care assessment was designed to capture patients' experiences of care in detail,...
- 20
- 551
- 0
luận văn Toxicity assessment of small molecules using the zebrafish as a model system
... ATGGGGTATTTGAGGGTCAG TACCCTCCTTGCGCTCAATC GCGATTCCTTTTGGAGAAGAC TCGATATCCACATCGTCAGC CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified ... in the dark Larvae responded to the onset of darkness with a strong startle, causing a maximal peak on the speed actogram, then their speed decreased as they adapted to darkness The habituation ... testing using zebrafish embryos among scientists (Figure 1. 2A) as well as legislators: The International Organization for Standardization (ISO) has standardized the zebrafish embryo test for waste...
- 58
- 262
- 0
báo cáo khoa học: " Healthcare professionals'''' intentions to use clinical guidelines: a survey using the theory of planned behaviour" doc
... were analysed via variance analysis with Welch 's and Gamess-Howell 's tests, which have been recommended for use in cases of unequal sample sizes and unequal variances [44] The main data analyses ... Professor Anna-Mari Aalto from the National Institute for Health and Welfare, who participated in designing the questionnaire; to assistants Tiina Tala, Saara Ojala, and Heidi Korhonen from the EBMeDS ... respondents These may cause non-response bias and, accordingly, problems in interpretation of the results [45] Since an internet-based webropol format was used, the response rate can be assessed by using...
- 10
- 289
- 0
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot
... care doctors Statistical analysis In all statistical analyses, the three targeted tests are reported and analysed separately In order to test the representativeness of our sample from within the ... to obtain data on individual primary care doctors’ requesting patterns from the administrative data systems The implication for statistical analysis was that some measure of practice-level psychological ... was calculated as the mean of all items contributing to the construct Cronbach s alpha was used to ascertain the reliability of each of the scales If reliability was lower than 0.7, an exploratory...
- 9
- 367
- 0
engle and lange-predicting vnet - a model of the dynamics of market depth
... back at Table 6, SPREAD is the least signi"cant explanatory variable in the model across the entire group of stocks This may re#ect the incompleteness of the bid}ask spread as a measure of liquidity, ... bid}ask spreads, at least for the 16 stocks in this study over the two periods being examined The dynamics of the bid}ask spread and its relationship to volatility may also have changed since the ... across adjacent price thresholds, but a joint test rejects the hypothesis that all eight models are statistically identical Of course, these tests not have standard distributions as the estimates...
- 30
- 308
- 0
The dynamics of literary representation and interpretation in a multilingual environment a study of selected malaysian and singaporean novels in english
... was well versed in Malay and Cantonese So the reader fully accepts the situation illustrated above as natural, that is, the narrator understands the languages spoken, and thus can translate them ... Here, the man called Stark speaks Malay to the servant and English to the narrator The switch from one language to another is only obvious because of the phrase “said Stark in Malay” at the beginning ... use of different levels of SingaporeMalayan English have gradually replaced vernacular transcriptions What makes a characteristically Singapore or Malaysian novel is the use of any of these strategies...
- 249
- 440
- 0
Establishing a filipino identity using the philosophy of michel focault
... this distance between them so as to bring language as close as possible to the observing gaze, and the things observed as close as possible to words Natural history is nothing more than nomination ... truth; that is, the types of discourse it accepts and makes function as true; the mechanisms and instances that enable one to distinguish true and false statements, the means by which each is sanctioned ... can say”.49 This statement raises two questions, one having to with the statement itself, and the other its implications for his own histories As far as the statement itself goes, there is a...
- 109
- 454
- 0
Removal of arsenic from synthetic groundwater by adsorption using the combination of laterite and ironmodified activated carbon
... Kawasaki s Laboratory, Tokyo Institute of Technology, Japan For this assistance, the research team expresses its most sincere gratitude REFERENCES Abhijit M., Sunando D G., Jayant K B and Sirshendu ... both LA and AC-Fe as shown in the values of the regression coefficient r2 Therefore, adsorption process of arsenic onto LA and AC-Fe may be described by Langmuir isotherm and the adsorption capacities ... silica with positive surface charge under normal conditions Therefore, LA can adsorb anionic contaminants as As[III] and As[V] (Larsson et al., 1999) A number of researchers (Larsson et al.,...
- 12
- 529
- 0
Coupled continuum equations - the dynamics of sandpile surfaces
... of a finite density ρ of flowing grains The analysis of Case A is straightforward, and was undertaken really only to explain features of the more complex Case C; that of Case B shows satisfactory ... smoothing: Cases A and C manifest this in the species h of stuck grains, while Case B manifests this in the species ρ of flowing grains We reiterate that the fundamental physical reason for this is the ... Firstly, the impact of a constant flux of saltating grains knocks grains out of the ‘bare’ surface, causing them to hop along the ripple surface and land in the layer of flowing grains This is the underlying...
- 28
- 228
- 0
Tài liệu Banks’ exposure to interest rate risk, their earnings from term transformation, and the dynamics of the term structure pptx
... the systematic factor of changes in the exposure to interest rate risk is closely related to the (past and present) steepness of the term structure The results shown in Table make it possible to ... literature of the banks’ interest rate risk (See Staikouras (2003) and Staikouras (2006) for a survey) The first one is about the determinants of the banks’ exposure to interest rate risk, and the ... month may also change systematically For instance, it may be the case that there is a cluster of observations of banks with large exposure to interest rate risk in certain months To show the problem...
- 40
- 551
- 1
Tài liệu Bank mergers and the dynamics of deposit interest rates doc
... bank and for the local market For individual banks, these are bank size (measured by the log of total assets), bank size squared and the share of deposits to total assets (lagged with one year ... mergers vary substantially across studies In this paper, we aim for a comprehensive empirical analysis of a bank merger s impact on deposit rate dynamics We base the analysis on a unique dataset comprising ... different specifications of Hannan and Prager s (1998) and Focarelli and Panetta s (2003) approaches The results of the estimations of these alternative models are available from the authors’ website.13...
- 44
- 381
- 0
Tài liệu Special RepoRt The Dynamics of Public Trust in Business— Emerging Opportunities for Leaders ppt
... business and the public This report is based on these panel discussions as well as leading academic scholarship in the area of trust, and a variety of survey data.8 Its creation began before the ... business Business, defined in this manner, is a moral enterprise Dealing with business and social issues as if they are separate endorses the archaic and destructive idea that business activity is ... Clearly, all businesses matter to one another This also indicates that the way business leaders react to malfeasance at other firms may be of critical importance to public trust in business—and...
- 39
- 512
- 0
Báo cáo khoa học: Protein stabilization by compatible solutes Effect of diglycerol phosphate on the dynamics of Desulfovibrio gigas rubredoxin studied by NMR docx
... (potassium salt) was added to a nal concentration of 100 mM, while in the other sample KCl was added to the same concentration The pH was adjusted to 6.9 in both samples and an antibiotic cocktail ... the rotational correlation time (sm) were evaluated prior to analysis The software package R1R2_DIFFUSION [31,40] was used to translate the centre of mass of the mean structure of the NMR ensemble ... model best tted the experimental data, and the structure was rotated to its principal axis for use in the model-free analysis The parameters, selected by extensive Monte-Carlo simulations as described...
- 9
- 366
- 0
Báo cáo khoa học: "Solving Relational Similarity Problems Using the Web as a Corpus" potx
... word sense disambiguation, and a set of linguistic features They test their system against both Lauer s prepositional paraphrases and another set of 21 semantic relations, achieving up to 54% accuracy ... Shinyama, Satoshi Sekine, and Kiyoshi Sudo 2002 Automatic paraphrase acquisition from news articles In Proceedings of HLT, pages 313–318 Marta Tatu and Dan Moldovan 2005 A semantic approach to ... vectors – one for each of the six word pairs We then calculate the relational similarity between the stem of the analogy and each of the five candidates, and we choose the pair with the highest score;...
- 9
- 390
- 0
Báo cáo khoa học: Intermonomer cross-linking of F-actin alters the dynamics of its interaction with H-meromyosin in the weak-binding state ppt
... course of actomyosin ATPase cycles The weak versus strong binding of the myosin S1 domain to labelled actin filaments causes opposing changes in polarization parameters Apparently, subdomain movement ... the same token, none changes the strong binding of myosin S1 to actin, nor they alter the Vmax and KM parameters of actomyosin ATPase activity or the rates of ADP release from acto -S1 [14,15] ... Hegyi and J Belagyi Cross-linking affects the dynamics of F-actin effect amounts to a decrease of s2 as a function of increasing thermal motions within the molecules According to the Goldman equation...
- 10
- 311
- 0
Using the Magic Pocket: A Dropbox Guide docx
... storage is storage that is not locally hosted The data is stored in physical media like any other data, but the storage media is a hard drive located in some far-off server farm instead of a ... data and can send that data to any other computer that is part of the cloud As a result it is no longer strictly accurate to simply say your data is stored on your PC Instead, the data is stored ... SpiderOak (http://www.makeuseof.com/tag/spideroak-online-data-backupsharing-solution-crossplatform/) – Slanted towards file backup as well as sharing, SpiderOak isn’t nearly as easy to use as...
- 36
- 321
- 0
Using the Magic Pocket: A Dropbox Guide
... computers, each of which stores the same data and can send that data to any other computer that is part of the cloud As a result it is no longer strictly accurate to simply say your data is stored ... that unfortunately has been butchered as of late, but at its core the term stands for a very specific way of storing data Cloud storage is storage that is not locally hosted The data is stored ... method of backing up information, but storage space is an issue None of the available accounts, free or paid, offer a massive amount of storage The limited storage space is not insurmountable,...
- 64
- 326
- 0
The Dynamics of Viral Marketing ∗ pot
... The classical disease propagation models are based on the stages of a disease in a host: a person is first susceptible to a disease, then if she is exposed to an infectious contact she can become ... recommendations For these reasons we cut-off the plot when the number of observations becomes too small and the error bars too large We calculate the purchase probabilities and the standard errors of the ... categories such as westerns, classics and Japanese animated films (anime), had connected components spanning about 20% of their members The insert in figure shows the growth of the customer base over...
- 46
- 422
- 0
the dynamics of social welfare policy sep 2003
... What has happened to social work in hospitals over the past twenty years is a clear example of this contrast Until the early 198 0s, the social problem that hospital workers addressed was straightforward: ... embodies social welfare policy? The leading professional organization, the National Association of Social Workers (NASW), offers one answer In its Code of Ethics, NASW states, A historic and defining ... one stage to another, they contend that history repeats itself Just as the days of the week repeat and the same seasons occur in every year, so history more closely resembles a circle rather than...
- 528
- 150
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008