0

using salary as a tiebreaker mine

Using Linux As A Router

Using Linux As A Router

Hệ điều hành

... convenient Slackware setup program to format and setup the root and swap partitions identically to the first machine Specifically, we made the root partition and the swap partition the same partition ... point-to-point daemon, supports "proxy arp," which lets you avoid wasting a network on the point-to-point link Basically, proxy arp makes your remote machine’s point-to-point interface appear as if it ... complications of ISDN or geographic distance We connected a hub and a PC to the cloned machine to simulate conditions at the remote site This was where routed caused everything to fall apart As soon...
  • 7
  • 460
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Reduced cytotoxicity of insulin-immobilized CdS quantum dots using PEG as a spacer" pot

Hóa học - Dầu khí

... (Figure 4a) and ICSNPs (Figure 4b) as measured by DLS The average size of CSNPs as determined by DLS was ca 21 nm On the other Figure XRD patterns of (a) mercaptoacetic acid-coated CSNPs and (b) bare ... (a) mercaptoacetic acid-coated CSNPs and (b) ICSNPs hand, the average sizes of ICSNPs were about 38 nm The size of the particles as determined by DLS was considerably larger than that determined ... (ICSNPs) having an average diameter of 13 nm as determined by TEM was narrow The proliferation of fibroblasts was significantly increased by the presence of ICSNPs ICSNPs also demonstrated lower...
  • 9
  • 403
  • 0
A study on the bennefits of using portfolios as a means of assessment in the writing development for the third year stdents of english at hanoi pedagogical university no 2

A study on the bennefits of using portfolios as a means of assessment in the writing development for the third year stdents of english at hanoi pedagogical university no 2

Anh văn thương mại

... for Languages EFL English as a Foreign Language ESL English as a Second Language FLF Foreign Language Faculty HPU2 Hanoi Pedagogical UniversityNo2 ULIS University of Languages and International ... Language Faculty, Hanoi Pedagogical University No Several papers and articles have investigated portfolios from the angle of an alternative assessment tool for traditional assessment Unfortunately, ... portfolio-based assessment began to attract attention around the mid-1980s as a reaction against the psychometric climate prevailing educational standards This atmosphere led to intense pressure to place...
  • 65
  • 893
  • 7
Students perceptions of using portfolios as a means of evaluation in an english foreign language translation course

Students perceptions of using portfolios as a means of evaluation in an english foreign language translation course

Ngữ pháp tiếng Anh

... Using Portfolios as a Means of Evaluation in an English Foreign Language Translation Course, a Case Study at the Faculty of Foreign Languages, Hanoi Pedagogical University N02” (Graduation paper ... in more foreign language classes Based on the results of the survey, it is clear that portfolio has a great of benefits; however both teachers and students also face some challenges when implementing ... portfolio as well as ways to improve students’ self-learning portfolio The participants of the survey questionnaires are 44 third-year English-major students of the Faculty of Foreign Languages, Hanoi...
  • 7
  • 361
  • 1
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY

USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY

Quản trị kinh doanh

... brand identity such as: • Brand identity is a unique set of brand associations that the brand strategist aspires to create or maintain These associations represent what the brand stands for and ... self-expression (Aaker, 1996) 2.7 Strategic Brand Management Brand management is above all about balancing variety of inputs Balances have to be struck between the external market and internal capabilities ... is still very weak, although the Director has paid attention to it The Company has an unclear management information system and lack of retailers and consumers database to manage the distribution...
  • 67
  • 974
  • 0
Screening of PHA-Producing Bacteria Using Biodiesel- Derived Waste Glycerol as a Sole Carbon Source

Screening of PHA-Producing Bacteria Using Biodiesel- Derived Waste Glycerol as a Sole Carbon Source

Môi trường

... periodate were added Afterwards, 1.2 mL of acetylacetone solution was added and the mixture was placed in a water bath at 70ºC for An absorbance measurement was made at 410 nm against a blank sample ... volume was transferred to a clean test tube, was evaporated and then mL of concentrated sulfuric acid was added The sample was boiled for 10 minutes An absorbance measurement was made at 235 nm using ... research, it can be concluded that AIK7 isolate could be a good candidate as a PHA producer by using this low-grade waste glycerol as a sole carbon source REFERENCES Anderson A J and Dawes E A...
  • 9
  • 688
  • 0
Using eliciting question as a technique to teach english to 11th form pupils

Using eliciting question as a technique to teach english to 11th form pupils

Khoa học xã hội

... their own ideas, their information, their available knowledge and basing on that the learners can understand the lesson and practice using the language better 1.3 Summary This chapter has been concerned ... understand the whole text such as a funny story Example: A tourist visiting a pub was fascinated by a stuffed lions head mounted on a mahogany plaque above a door behind the bar Is there a story ... attractive and more interesting and make pupils more motivated Eliciting questions are also a mean to check up and to give teachersnecessaryinformation such as: which parts pupils have already...
  • 42
  • 641
  • 0
Tài liệu Using a Web Service as a Data Source pdf

Tài liệu Using a Web Service as a Data Source pdf

Kỹ thuật lập trình

... "Order_OrderDetails_Relation"; // [WebMethod] public DataSet LoadOrders( ) { DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet da = new SqlDataAdapter("SELECT ... OrderDetails table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM [Order Details]", ConfigurationSettings.AppSettings["DataConnectString"]); DataTable orderDetailTable = new DataTable(ORDERDETAILS_TABLE); ... ConfigurationSettings.AppSettings["DataConnectString"]); DataTable orderTable = new DataTable(ORDERS_TABLE); da.FillSchema(orderTable, SchemaType.Source); da.Fill(orderTable); ds.Tables.Add(orderTable);...
  • 4
  • 369
  • 0
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

Khoa học xã hội

... test was within fifteen minutes During the test, the teacher worked as a cassette player and examiner The marking was done with the same way of assessment and then was analyzed in turn The class ... for this task must have quite easy language and sung at a low speed such as ‘ whatever will be will be’ To carry out this task, teacher can omit some passage of the song word and then ask students ... years; teachers and researchers believe that motivation plays an important part in the process of acquiring an additional language because motivated students are usually those who participate actively...
  • 39
  • 1,125
  • 3
Tài liệu Using Proven Sales Techniques for Selling WorkKeys as a Solution to Business doc

Tài liệu Using Proven Sales Techniques for Selling WorkKeys as a Solution to Business doc

Tiếp thị - Bán hàng

... Yellow Steadiness Cautious Dominance Influence Beaver Owl Fox Dolphin Dove Owl Eagle Peacock Abraham Moses Paul Peter Charlotte York Miranda Hobbes Samantha Jones Carrie Bradshaw Pooh Eeyore Rabbit ... Biblical Characters Sex in the City Winnie the Pooh Characters 28 Needs Differ by Type Art of Relating Amiable Analytical Driver Expressive maintain relationship task/ process task/ results relationship/ ... 27 Personality Type History Xerox Selling System Amiable Analytical Driver Expressive Temperament Types - Jung Epemethean Promethean Dionysian Apollonian Guardian Rational Artisan Idealist ISFJ...
  • 48
  • 482
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Using an Annotated Corpus as a Stochastic Grammar" ppt

Báo cáo khoa học

... annotated corpus as a stochastic grammar We restricted ourselves to substitution as the only combination operation between corpus subtrees A 43 M Marcus, 1991 "Very Large Annotated Database of America~ ... Newark P Resnik, 1992 "Probabilistic Tree-Adjoining Grammar as a Framework for Statistical Natural Language Processing", Proceedings COLING92, Nantes R Scha, 1990 "Language Theory and Language ... America~ English" DARPA Speech and Naawal Language Workshop, ~ Grove, Morgan Kaufmarm F Pereira and Y Schabes, 1992 "Inside-Outside Reestimation from Partially Bracketed Corlmra', ProceedingsACY.,92,...
  • 8
  • 393
  • 0
Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc

Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc

Sức khỏe phụ nữ

... breeders served as untreated controls Sham-treated animals underwent all preparations for ultrasound treatment as treated animals: anesthesia was administered and maintained at - 2.5% isoflurane/oxygen, ... ME7410 transducer only produced MHz ultrasound Treatment apparatus A Plexiglas cylinder was used as the ultrasound chamber (70 mm diameter, 25 mm tall) The bottom of this chamber was a single layer ... scrotal fur was shaved, a ligature was used to retain the testes in the scrotum, room temperature coupling medium was placed in the treatment chamber, animal was placed on the treatment apparatus...
  • 15
  • 967
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Solving Relational Similarity Problems Using the Web as a Corpus" potx

Báo cáo khoa học

... 2.3 Paraphrase Acquisition Our method of extraction of paraphrasing verbs and prepositions is similar to previous paraphrase acquisition approaches Lin and Pantel (2001) extract paraphrases from ... relations, 12 classes: evaluation on Levi-214 dataset Shown are micro-averaged accuracy and coverage in %s, followed by average number of features (ANF) and average sum of feature frequencies (ASF) ... verbal analogy problems, yielding 47% accuracy The same approach is applied to classifying noun-modifier pairs: using the Diverse dataset of Nastase and Szpakowicz (2003), Turney&Littman achieve...
  • 9
  • 390
  • 0
Fabrication of a porous polyimide membrane using a silicon nanowire array as a template

Fabrication of a porous polyimide membrane using a silicon nanowire array as a template

Vật lý

... expected to increase the ranges of the pore diameters and densities formed Conclusions Our studies indicate that silicon nanowires can be used as sacrificial templates for the fabrication of porous ... factors only; namely, template-nanowire diameter and the duration of XeF2 etching On the other hand, wire diameter is determined by gold nanoparticle size and is slightly larger than the AuNP seeds ... substrates Final membrane thickness can be adjusted by simply altering the amount of solution applied About 5–10 μl of polyimide solution was found to be appropriate for a silicon substrate of...
  • 4
  • 349
  • 0
Báo cáo

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Báo cáo khoa học

... those  measures  that  are  being  used  in the target areas as well as foreign countries,  such  as Indonesia,  China,  Bangladesh,  Germany,  Mexico,  Colombia,  USA.  Some  of  them are introduced as follows.  ... Table 7. Standardized score for costs of combinations  Measure  A1 +A2 .3  A1 +B1  A1 +B2  A1 +B1+B2  A2 .1 +A2 .3  A2 .1+B1  A2 .2 +A2 .3  A2 .2+B1  A2 .3+B1  A2 .3+B1+B2  Standardized cost  Standardized score ... doing so, the consensus on the problems and  their solutions can be reached. However, it is  noted that MCA is subjective in its nature. In  case  the  quantitative  data  are  available,  quantitative  analysis  (i.e.  numerical ...
  • 13
  • 487
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

Điện - Điện tử

... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...
  • 10
  • 541
  • 0
báo cáo hóa học:

báo cáo hóa học:" Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pdf

Hóa học - Dầu khí

... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...
  • 10
  • 401
  • 0

Xem thêm