using a single marker for all vertices

Báo cáo hóa học: " Research Article Fully Adaptive Clutter Suppression for Airborne Multichannel Phase Array Radar Using a Single A/D Converter" potx

Báo cáo hóa học: " Research Article Fully Adaptive Clutter Suppression for Airborne Multichannel Phase Array Radar Using a Single A/D Converter" potx

Ngày tải lên : 21/06/2014, 08:20
... to achieve full adaptivity to the clutter, generally the radar system has to undergo a multiple -A/ D (hardware) upgrade where a number of sampled data streams are made available However, for practical ... nonadaptive single A/ D-basedFFT solution, as well as potential multichannel upgrades, we would like to establish a theoretical space-time clutter covariance matrix for each case using the parameters ... variance and E{·} denotes the expectation operator The usual assumptions such as patchto-patch statistical independence (zero-mean Gaussian) are made on the clutter as well as target The data...
  • 14
  • 342
  • 0
Báo cáo hóa học: " Research Article Pose-Encoded Spherical Harmonics for Face Recognition and Synthesis Using a Single Image" docx

Báo cáo hóa học: " Research Article Pose-Encoded Spherical Harmonics for Face Recognition and Synthesis Using a Single Image" docx

Ngày tải lên : 22/06/2014, 19:20
... length f has to be assumed known, which is not always available for the uncontrollable test image We take the advantage that the facial features on the frontal view mean face are available, and show ... 3D face scans For a test image at a rotated pose and under an arbitrary illumination condition, we manually establish the image correspondence between the test image and a mean face image at the ... are available, but most of them are not robust enough to reliably detect the facial features from images at arbitrary poses and are taken under arbitrary lighting conditions For now, we manually...
  • 18
  • 354
  • 0
Tài liệu Module 3: Using a Conceptual Design for Data Requirements docx

Tài liệu Module 3: Using a Conceptual Design for Data Requirements docx

Ngày tải lên : 10/12/2013, 17:15
... the solution’s overall data design If a solution has no data requirements, it has no need for data storage, let alone a logical data organization Determining the functional data requirements from ... skills and experience necessary to perform a task • Collect artifacts, such as printed documentation and manuals 50 Module 3: Using a Conceptual Design for Data Requirements Analyzing Information ... important to superfluous Validation Information provided is not always accurate, so it is important for the team to validate the information gathered One method of validating information is to gather...
  • 20
  • 580
  • 0
Tài liệu Instructor Notes Module 3: Using a Conceptual Design for Data Requirements pdf

Tài liệu Instructor Notes Module 3: Using a Conceptual Design for Data Requirements pdf

Ngày tải lên : 17/01/2014, 09:20
... be able to: • Discuss use cases, data requirements, and requirements validation as they relate to conceptual design for data systems ! To prepare for the activity • Review the activity and anticipate ... Module 3: Using a Conceptual Design for Data Requirements Activities Activity 3.1: Identifying Data-Related Use Cases and Data Requirements In this activity, students will determine data requirements, ... Many students with database backgrounds will want to think and work in the physical data model Remind them that, at this point, the work is still in the conceptual phase THIS PAGE INTENTIONALLY...
  • 4
  • 447
  • 0
Tài liệu Using a Single Stored Procedure to Update Multiple Changes to a SQL Server Database pdf

Tài liệu Using a Single Stored Procedure to Update Multiple Changes to a SQL Server Database pdf

Ngày tải lên : 21/01/2014, 11:20
... schema and data for the table da.FillSchema(ds, SchemaType.Source, TABLENAME); da.Fill(ds, TABLENAME); // Columns in XML representation of data as attributes foreach(DataColumn col in ds.Tables[TABLENAME].Columns) ... System.EventArgs e) { ds = new DataSet( ); // Create the DataAdapter SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM " + TABLENAME, ConfigurationSettings.AppSettings["Sql_ConnectString"]); // Load ... SP0811_Update is called to update the database with the batched changes Example 8-16 Stored procedure: SP0811_Update ALTER PROC SP0811_Update @data ntext = null, @datadelete ntext = null AS DECLARE...
  • 7
  • 442
  • 0
Tài liệu Báo cáo khoa học: "Joint Word Segmentation and POS Tagging using a Single Perceptron" docx

Tài liệu Báo cáo khoa học: "Joint Word Segmentation and POS Tagging using a Single Perceptron" docx

Ngày tải lên : 20/02/2014, 09:20
... worked well for word segmentation alone (Zhang and Clark, 2007), even with an agenda size as small as 8, and a simple beam search algorithm also works well for POS tagging (Ratnaparkhi, 1996) ... Barcelona, Spain Adwait Ratnaparkhi 1996 A maximum entropy model for part-of-speech tagging In Proceedings of the EMNLP Conference, pages 133–142, Philadelphia, PA Murat Saraclar and Brian Roark ... the tag dictionary The character category features (templates 15 and 16 in Table 2) represent a Chinese character by all the tags associated with the character in the training data They have been...
  • 9
  • 576
  • 0
A Complete Guide for All Ages: Easy to understand information from the nation’s leaders in women’s health doc

A Complete Guide for All Ages: Easy to understand information from the nation’s leaders in women’s health doc

Ngày tải lên : 14/03/2014, 12:20
... you’re an African American, Hispanic, American Indian/Alaska Native, Asian American, or Pacific Islander woman, you’re more than twice as likely as a Caucasian woman to get type diabetes What is ... coronary artery disease The Healthy Woman: A Complete Guide for All Ages Heart Attack: Warning Signs Many people think a heart attack is sudden and intense, like a “movie” heart attack, where a ... as a heart attack In a heart attack, the heart usually does not suddenly stop beating But sudden cardiac arrest may happen during recovery from a heart attack Living with heart disease If you are...
  • 177
  • 560
  • 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Ngày tải lên : 23/03/2014, 15:21
... text for details), although it was not detected by the immunological assays Psb P Cyanobacteria Glaucophyceae Red algae Diatoms Haptophyceae Brown algae Prasinophyceae Euglenophyceae Green algae ... Cyanobacteria Synechocystis sp PCC6803 Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana ... were also found in all cyanobacteria and green oxyphotobacteria analyzed (d) PsbQ is present in green algae and higher plants, and psbQ-like genes were found in most of cyanobacteria and a red alga...
  • 11
  • 501
  • 0
Báo cáo sinh học: "Glutamate carboxypeptidase activity in human skin biopsies as a pharmacodynamic marker for clinical studies" docx

Báo cáo sinh học: "Glutamate carboxypeptidase activity in human skin biopsies as a pharmacodynamic marker for clinical studies" docx

Ngày tải lên : 18/06/2014, 19:20
... (Milford, MA, USA) Separation of the analytes from potentially interfering material was achieved at ambient temperature using a Waters Altantis column (100 × 2.1 mm i.d.) packed with a μm ODS stationary ... was readily detected (Figure 3A) and the chromatographic peaks of 2-PMPA and internal standard (Figure 3B) allowed for quantitation of material in the Rojas et al Journal of Translational Medicine ... activity assay provides a simple and direct measurement of GCP activity from tissue samples easily assessable in human subjects Abbreviations GCP: glutamate carboxypeptidase; NAAG: N-acetyl-aspartyl-glutamate;...
  • 8
  • 406
  • 0
báo cáo hóa học:" Glutamate carboxypeptidase activity in human skin biopsies as a pharmacodynamic marker for clinical studies" doc

báo cáo hóa học:" Glutamate carboxypeptidase activity in human skin biopsies as a pharmacodynamic marker for clinical studies" doc

Ngày tải lên : 20/06/2014, 03:20
... (Milford, MA, USA) Separation of the analytes from potentially interfering material was achieved at ambient temperature using a Waters Altantis column (100 × 2.1 mm i.d.) packed with a μm ODS stationary ... was readily detected (Figure 3A) and the chromatographic peaks of 2-PMPA and internal standard (Figure 3B) allowed for quantitation of material in the Rojas et al Journal of Translational Medicine ... activity assay provides a simple and direct measurement of GCP activity from tissue samples easily assessable in human subjects Abbreviations GCP: glutamate carboxypeptidase; NAAG: N-acetyl-aspartyl-glutamate;...
  • 8
  • 304
  • 0
báo cáo hóa học:" Repositioning and stabilization of the radial styloid process in comminuted fractures of the distal radius using a single approach: the radio-volar double plating technique" pot

báo cáo hóa học:" Repositioning and stabilization of the radial styloid process in comminuted fractures of the distal radius using a single approach: the radio-volar double plating technique" pot

Ngày tải lên : 20/06/2014, 04:20
... visual analog scale [17] Additionally all patients completed the Gartland and Werley score [18] and the patient-rated wrist evaluation [19] Radiological analysis included fracture AO-classification ... the volar plate, whereas the radial plate acts as a buttress plate holding the radial styloid fragments in place Figure Illustrated case (postoperative radiographs) The fracture is anatomically ... supplementary fixation (e.g., dorsal plating or a supplementary approach such as a dorsal approach) where excluded Indication for volar and, if judged necessary, radial plating, was a choice of...
  • 6
  • 503
  • 0
Báo cáo khoa học: " Investigation of tumor hypoxia using a twoenzyme system for in vitro generation of oxygen deficiency" pot

Báo cáo khoa học: " Investigation of tumor hypoxia using a twoenzyme system for in vitro generation of oxygen deficiency" pot

Ngày tải lên : 09/08/2014, 09:20
... angiogenesis.dkfz.de/oncoexpress/software/sumo/) was used for statistical analysis, two-class t-tests and GOanalysis Pathway analysis was performed based on information available on cellular signalling processes from a curated database ... microarray analysis was also performed for RNA isolated from cells incubated for the same time period (24 h) under normoxic conditions For bioinformatical-analysis a step-wise approach was applied: ... of vital cells after irradiation, compared to the non-irradiated control was calculated Statistical analysis Statistical analysis of the genomics was performed with SUMO (Christian Schwager,...
  • 12
  • 306
  • 0
Báo cáo y học: "Direct cord implantation in brachial plexus avulsions: revised technique using a single stage combined anterior (first) posterior (second) approach and end-to-side side-to-side grafting neurorrhaphy" pot

Báo cáo y học: "Direct cord implantation in brachial plexus avulsions: revised technique using a single stage combined anterior (first) posterior (second) approach and end-to-side side-to-side grafting neurorrhaphy" pot

Ngày tải lên : 10/08/2014, 10:20
... radioopaque marker hemoclips and inserted carefully into the paraspinal muscles toward the anterior suprascapular region Several days later, and through an anterior supraclaviclar approach, the ... study All authors read and approved the final manuscript SMA wrote the rough draft Brachial plexus exploration was carried out by SMA, ANM, RERE Cervical laminectomy was carried out by SMA and AMK ... long axis of the arm and the forearm The range of abduction was recorded by measuring the angle formed between the arm axis and parallel to the spinal cord axis External rotation was measured...
  • 17
  • 424
  • 0
báo cáo khoa học: " Using a summary measure for multiple quality indicators in primary care: the Summary QUality InDex (SQUID)" ppt

báo cáo khoa học: " Using a summary measure for multiple quality indicators in primary care: the Summary QUality InDex (SQUID)" ppt

Ngày tải lên : 11/08/2014, 05:22
... They appreciate its use for tracking a summary measure of quality over time, and are excited about its potential for appealing internally to their clinical and clerical staff, as well as externally ... practice performance reports (audit and feedback), optional semi-annual site visits to practices for academic detailing and participatory planning, and optional annual network meetings to share ... [http://www.ama-assn.org/ama/upload/mm/370/ introperfmeasurement.pdf] Guidelines for the evaluation and management of heart failure Report of the American College of Cardiology/American Heart Association...
  • 12
  • 315
  • 0
Báo cáo khoa học: "Elimination of Mange Mites Sarcoptes scabiei var. suis from Two Naturally Infested Danish Sow Herds Using a Single Injection Regime with Doramectin" pdf

Báo cáo khoa học: "Elimination of Mange Mites Sarcoptes scabiei var. suis from Two Naturally Infested Danish Sow Herds Using a Single Injection Regime with Doramectin" pdf

Ngày tải lên : 12/08/2014, 15:20
... other areas of the body Animals were restrained, and the area was scraped with a sharp spoon until blood was visible The material obtained from the scraped area was transferred into a Vacutainer® ... days of age Housing: Gestation and mating areas, as well as farrowing pens, had slatted flooring Pregnant sows were kept in stalls Pigs were weaned into a climate-controlled 2-stage weaning accommodation, ... elimination attempt (Reddin 1997) Avermectins, as well as other acaricides, are not effective against mite eggs (Alva-Vades et al 1984) In order to achieve elimination of mange from a naturally...
  • 10
  • 260
  • 0
Báo cáo y học: " A single site for N-linked glycosylation in the envelope glycoprotein of feline immunodeficiency virus modulates the virus-receptor interaction" ppt

Báo cáo y học: " A single site for N-linked glycosylation in the envelope glycoprotein of feline immunodeficiency virus modulates the virus-receptor interaction" ppt

Ngày tải lên : 13/08/2014, 05:21
... 16 (page number not for citation purposes) Retrovirology 2008, 5:77 GATTTTTAAGGTATTC (5' MLU) and either 5'-CGAGATATTATAACAGATGTTATTAGCACAT-3' (ENV 7076) or 5' GGTCTTGAATCTGTGAAGTGTACCACATA (ENV ... by amplifying the SU coding sequence with the oligonucleotide primers 5'-CGATCTAGAAACAATAATTATGGCAGAAG-3' and 5'-GGCGGCCGCTGGTACCAC(C/T)AAGTAATC-3' corresponding to the start codon for Env leader ... [37-42] Accordingly, the FL4 cell line has provided the basis for the first commercially available FIV vaccine (Fel-O-Vax FIV, Fort Dodge), approved for use in the USA, Japan, New Zealand and Australia...
  • 16
  • 428
  • 0
INTERLEUKIN 6 RELEASE FROM t98g HUMAN GLIAL CELL LINE AS a PREDICTIVE MARKER FOR CHRONIC PAIN, AND THE CHARACTERIZATION OF SUBSTANCE(S) INVOLVED IN PAIN

INTERLEUKIN 6 RELEASE FROM t98g HUMAN GLIAL CELL LINE AS a PREDICTIVE MARKER FOR CHRONIC PAIN, AND THE CHARACTERIZATION OF SUBSTANCE(S) INVOLVED IN PAIN

Ngày tải lên : 02/10/2015, 17:15
... that glial cells also play a part in exaggerated pain states created by inflammation and neuropathy (Hashizume et al., 2000; Watkins and Maier, 2002) Astrocytes, in particular, play an important ... my days as a researcher Thank you both so much for all the fun and laughter you have brought to my days in the laboratory I am also very grateful to Ms Jeyapriya Raja Sundaram for her help and ... rather at the fundamental mechanisms that are responsible for the pain Table 1-1 Common pharmacological treatments for chronic pain Class of drugs NSAIDs1 Side effects Nausea, abdominal pain, diarrhea,...
  • 136
  • 600
  • 0
Báo cáo y học: "Assignment of isochores for all completely sequenced vertebrate genomes using a consensus" pot

Báo cáo y học: "Assignment of isochores for all completely sequenced vertebrate genomes using a consensus" pot

Ngày tải lên : 14/08/2014, 20:22
... equally classified human DNA ranges from 59-86% in an all- against -all pairwise comparison On average, all methods agree in about 66% of the genome The consensus isochore map has the best agreement ... TS and DF wrote the manuscript All authors read and approved the final manuscript 14 Additional data files 15 The following additional data are available with the online version of this paper Additional ... Additionally we show in Additional data file that all methods make a complementary contribution to the consensus maps throughout all genomes Methods that rely on any information beyond the raw...
  • 14
  • 224
  • 0
STRATEGIC PLANNING FOR PROJECT MANAGEMENT USING a PROJECT MANAGEMENT

STRATEGIC PLANNING FOR PROJECT MANAGEMENT USING a PROJECT MANAGEMENT

Ngày tải lên : 14/08/2013, 13:47
... what they can Although all organizations have strengths and weaknesses, no organization is equally strong in all areas Procter & Gamble, Budweiser, Coke, and Pepsi are all known for their advertising ... individuals are not only af- 9755.ch01 10/31/00 9:42 AM Page 5 Gap Analysis fected by the organization’s performance, but may even have a claim on its performance As an example, unions can have a strong ... critical success factors: qualitative factors, organizational factors, and quantitative factors To take advantage of the economic outlook, whatever it happened to be at a given time, senior managers...
  • 271
  • 629
  • 2
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm

Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm

Ngày tải lên : 05/09/2013, 17:03
... pp.927-938 935 (a) Best, mean and median objective valuses for Case I (b) Standard deviations for Case I (c) Best, mean and median objective values for Case II (d) Standard deviations for Case II Figure ... optimization for VAWT wind farm The results are given in Table The optimal layout is the same as that of a HAWT as shown in Figure Table Optimization results for VAWT wind farm Optimization Objective ... Table Case III has been taken from the paper of Yan et al [12] and Case III has a double rotor radius compared to Case IV so that the tip-speed ratio also doubles Again, the size of the farm is...
  • 12
  • 635
  • 1