use of c elegans for the study of volatile anesthetics

Báo cáo khoa học: " Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" ppsx

Báo cáo khoa học: " Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" ppsx

Ngày tải lên : 12/08/2014, 04:21
... localization of β-Catenin in transformed cells has been well documented [42], the loss of this cancer-specific phenotype in the 3-D cultured Huh7 aggregates is consistent with the loss of cancer-specific ... localized both in 2-D and 3-D Huh7 cultures; however, there was a profound decrease in the accumulation of nuclear β-Catenin-containing complexes in the 3-D Huh7 aggregates Because atypical nuclear ... cell culture-propagated HCV (HCVcc) viral stocks were obtained by infection of naïve Huh7-1 cells at a multiplicity of infection (MOI) of 0.01 focus forming units (FFU)/ cell, using medium collected...
  • 8
  • 326
  • 0
Báo cáo khoa học: "Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" pdf

Báo cáo khoa học: "Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" pdf

Ngày tải lên : 12/08/2014, 04:22
... localization of β-Catenin in transformed cells has been well documented [42], the loss of this cancer-specific phenotype in the 3-D cultured Huh7 aggregates is consistent with the loss of cancer-specific ... localized both in 2-D and 3-D Huh7 cultures; however, there was a profound decrease in the accumulation of nuclear β-Catenin-containing complexes in the 3-D Huh7 aggregates Because atypical nuclear ... cell culture-propagated HCV (HCVcc) viral stocks were obtained by infection of naïve Huh7-1 cells at a multiplicity of infection (MOI) of 0.01 focus forming units (FFU)/ cell, using medium collected...
  • 8
  • 642
  • 0
Báo cáo y học: "Use of a multi-virus array for the study of human viral and retroviral pathogens: gene expression studies and ChIP-chip analysis" pot

Báo cáo y học: "Use of a multi-virus array for the study of human viral and retroviral pathogens: gene expression studies and ChIP-chip analysis" pot

Ngày tải lên : 13/08/2014, 13:20
... range, Cy3 [69] We treated the Cy3 and adjusted Cy5 intensities as technical replicates and calculated the mean of these values The ratio of this mean on the average of the intensity across the ... amplicons contain some overlap, with 84% of the Rev amplicon specific to Rev and 65% of the Tat amplicon specific to Tat Tat and Rev indicated in the graph correspond to the amplicons that contain ... is a schematic of the KSHV genome indicating the location and direction of transcription of the ORFs ORFs indicated in white were not included in the analysis as the corresponding amplicons were...
  • 15
  • 376
  • 0
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor

A park like transformation for the study and the control of a nonsinusoidal brushless DC motor

Ngày tải lên : 03/01/2014, 19:44
... are The electrical equations of the machine can therefore be written as follows : are the backemf (p is the number of pairs of poles of the machine, is its instantaneous position and Cl is the ... reach an efficient control of the instantaneous torque of a non-sinusoidal brushless DC motor The classical ways of traclang off-line computed optimal current shape (the so-called "abc" frame current ... optimize the efficiency of the drive In this work, we will show how an extension of the Park transformation will lead to the 'jxeudo-dq" components of the electric variables The electric equations of...
  • 8
  • 517
  • 1
Tài liệu Towards a framework for the study of the neural correlates of aesthetic preference pdf

Tài liệu Towards a framework for the study of the neural correlates of aesthetic preference pdf

Ngày tải lên : 19/02/2014, 17:20
... correlates of aesthetic preference 385 The second unexpected fact is the complete lack of coincidence among the results of the three studies when comparing their results regarding the difference in ... model which are not accounted for by that of Chatterjee (2003), such as the context in which the experience takes place, pre-classification processes, the role of expertise and the influence of individual ... AESTHETIC PREFERENCE We have discussed the possible reasons for the lack of coincidence among the results of three neuroimaging studies addressing the neural correlates of aesthetic preference,...
  • 19
  • 526
  • 0
Report Of The Committee On Proposal Evaluation For Allocation Of Supercomputing Time For The Study Of Molecular Dynamics pptx

Report Of The Committee On Proposal Evaluation For Allocation Of Supercomputing Time For The Study Of Molecular Dynamics pptx

Ngày tải lên : 16/03/2014, 15:20
... Research and the National Academy of Sciences and was performed under the auspices of the National Research Council’s Board on Life Sciences To undertake this task, the National Research Council convened ... Allocation of Supercomputing Time for the Study of Molecular Dynamics, Second Round Committee on Proposal Evaluation for Allocation of Supercomputing Time for the Study of Molecular Dynamics, Second ... Supercomputing Center (PSC), based on the advice of a previous National Research Council committee convened in the fall of 2010 The success of the program has led DESRES to make the Anton machine...
  • 10
  • 557
  • 0
Báo cáo khoa học: Data-driven docking for the study of biomolecular complexes pptx

Báo cáo khoa học: Data-driven docking for the study of biomolecular complexes pptx

Ngày tải lên : 30/03/2014, 15:20
... respect to the surface of phospholipid vesicles was studied For the C2 domain of protein kinase A, fluorescence and EPR data were used to elucidate the surface of the protein that contacts the ... In the case of the transient complex between the yeast copper chaperone Atx1 and the first soluble domain of the copper-transporting ATPase Cccp2, a copper ion was explicitly introduced into the ... into which the structures of known constituents of a complex can be fitted Cryo-electron microscopy has been used for a large number of yeast complexes [115] and for the 80S ribosome from S cerevisase...
  • 20
  • 489
  • 0
báo cáo hóa học: " Muscle-driven forward dynamic simulations for the study of normal and pathological gait" potx

báo cáo hóa học: " Muscle-driven forward dynamic simulations for the study of normal and pathological gait" potx

Ngày tải lên : 19/06/2014, 10:20
... http://www.jneuroengrehab.com/content/3/1/5 forces, but other choices for the performance criterion can provide useful information about walking mechanics Noting that the energetic cost of locomotion (energy consumed ... of these choices has the potential to affect the performance of the simulation and thus may also affect the validity of clinical applications of such models Knowledge of the forces carried by ligaments, ... produced by muscle forces During the simulation, accelerations are produced by forces acting in combination: multiple muscle forces, gravity, and ground reaction forces, for example To determine the...
  • 7
  • 498
  • 0
A FUNCTIONAL-ANALYTIC METHOD FOR THE STUDY OF DIFFERENCE EQUATIONS EUGENIA N. PETROPOULOU AND potx

A FUNCTIONAL-ANALYTIC METHOD FOR THE STUDY OF DIFFERENCE EQUATIONS EUGENIA N. PETROPOULOU AND potx

Ngày tải lên : 23/06/2014, 00:20
... in Section (For a sketch of the main ideas used in the proofs of our main results, see the beginning of Section 3.) By use of this method, the linear or nonlinear difference equation under consideration ... (for more details, see [11] and the references therein) Also, by assuring the existence of a solution of a difference equation in the space or , we obtain information regarding the asymptotic ... fixed point theorems) from the wealth of operator theory, in order to assure the existence of a unique solution of the operator equation in H or H1 In the case of linear equations, we use the following...
  • 12
  • 257
  • 0
Báo cáo y học: "Autoantibody profiling for the study and treatment of autoimmune disease" docx

Báo cáo y học: "Autoantibody profiling for the study and treatment of autoimmune disease" docx

Ngày tải lên : 09/08/2014, 06:22
... Estimated capacity per array Fluorescence Colorimetric Fluorescence; analysis of individual beads using a flow cytometer Light microscopy; fluorescence; mass spectrometry Chemiluminescence Direct labeling ... This far exceeds the complexity of fluorescence-based bead and tag systems Microfluidics approaches Microfluidics utilizes microchannels for analysis of antigen–autoantibody interactions Small ... peptide epitope specificity of the autoreactive T-cell and B-cell responses, there is a high degree of concordance between autoreactive B-cell and T-cell responses at the macromolecular level [23,34]...
  • 6
  • 421
  • 0
Báo cáo y học: " The utilization of humanized mouse models for the study of human retroviral infections" docx

Báo cáo y học: " The utilization of humanized mouse models for the study of human retroviral infections" docx

Ngày tải lên : 12/08/2014, 23:22
... receptor CD4 and the coreceptors CCR5 and CXCR4 Genetic variability in the expression of these cell surface markers can lead to differences in susceptibility by socalled R5 viruses which recognize ... recognize CCR5, R5X4 viruses which recognize both CCR5 and CXCR4, and X4 viruses which recognize only CXCR4 [6-8] The activity and longevity of the integrated HIV-1 provirus can be directly correlated ... infection in the form of cytotoxic T lymphocyte (CTLs) CD8+ cells that recognize HIV-1 infected cells and induce cell death [1113] This CD8+ CTL response correlates with the production of HIV-1 neutralizing...
  • 18
  • 313
  • 0
HYDRODYNAMIC DELIVERY FOR THE STUDY, TREATMENT AND PREVENTION OF ACUTE KIDNEY INJURY

HYDRODYNAMIC DELIVERY FOR THE STUDY, TREATMENT AND PREVENTION OF ACUTE KIDNEY INJURY

Ngày tải lên : 24/08/2014, 12:58
... access the subcellular compartment containing the RNA-induced silencing complex (RISC) and other components of the RNAi machinery113,114 This subcelllular compartment is located in the perinuclear ... possibly one of the most promising therapeutic strategies, because for the first time, it 12 enables the silencing of any gene96 This may be crucial for the development of clinical gene therapies, ... mechanisms are the most common causes of AKI3 Second, intrinsic AKI is produced by direct kidney damage that can occur during accidents and surgery Third, postrenal AKI occurs as a consequence of uniary...
  • 268
  • 288
  • 0
Development of a fluorescence correlation spectroscopy method for the study of biomolecular interactions

Development of a fluorescence correlation spectroscopy method for the study of biomolecular interactions

Ngày tải lên : 14/09/2015, 10:36
... deoxyribonucleic acid EGFR epidermal growth factor receptor FCCS fluorescence cross-correlation spectroscopy FCS fluorescence correlation spectroscopy FFS fluorescence fluctuation spectroscopy FIDA fluorescence ... to the concentration of the dual-color complexes formed This easily distinguishes the products from the free reactants via the amplitude of the CCF, as compared to the weak dependence of the ACF ... [L], to the concentration of the complex [RL] The concentrations of the free components are then given by the total concentration of receptor [R]t or ligand [L]t minus the concentration of receptor-ligand...
  • 162
  • 393
  • 0
An asthma allergen specific animal model for the study of responses to dust mite allergen induced asthma

An asthma allergen specific animal model for the study of responses to dust mite allergen induced asthma

Ngày tải lên : 15/09/2015, 21:56
... synthetic peptides encoding T cell epitopes as a form of immunotherapy Characterize and clone TCR genes of Der p 1-specific CD8 T cells for the production of TCR transgenic mice Establish the role ... tracking these cells, we produced class I MHC tetramers capable of staining CD8 T cells specific for Der p We also explored the possibility of producing TCR transgenic mice with CD8 T cells recognizing ... we cloned and characterized the T cell receptor (TCR) gene from a Der p specific CD8 T cell The TCR genes were cloned into expression cassettes for the generation of TCR transgenic mice with CD8...
  • 254
  • 302
  • 0
Inverse modeling for the study of 2d doping profile of submicron transistor using process and device simulation

Inverse modeling for the study of 2d doping profile of submicron transistor using process and device simulation

Ngày tải lên : 08/11/2015, 16:45
... short-channel effect is believed to be caused by the enhanced diffusion of dopants near the source/ drain junction regions [1] Hence a technique for the extraction of 2D doping profile becomes ... each implanted ion displaces a silicon atom and produce an interstitialvacancy pair, the recombination of vacancies at the surface leaves an additional excess of interstitials, which is accounted ... is the concentration of interstitials calculated accourding to the Hobler and Selberher model and C is the change in concentration of implanted ion 2.1.2 Diffusion model selection Since all the...
  • 112
  • 310
  • 0
Gene targeting in human pluripotent cell derived neural stem cells for the study and treatment of neurological disorders

Gene targeting in human pluripotent cell derived neural stem cells for the study and treatment of neurological disorders

Ngày tải lên : 26/11/2015, 09:54
... TATGGATCCA^CTAGTTATGTAAATACAAACACAGAAAACCAA SpeI P3 downstream fw P4 GGGTTCCTGC^GGCCGCCTACTACTAATTGGCCAAAGTTTAA downstream HA rv GA NotI P5 Sca3 fw AGCACTTCCATATTTTAAAGTAATCTG P6 Sca3 rv TGCTCCTTAATCCAGGGAAA ... TTGCAGATGATTTTGCACCT P8 ADK rv GACCCCTTTGGGGTATCTGT P9 Neo fw GCTTGGGTGGAGAGGCTATT P10 Neo rv GCGATACCGTAAAGCACGAG P11 QuikChange fw GCAGCAGGGGGACCTGTCAGGACAGAGTT P12 QuikChange rv AACTCTGTCCTGACAGGTCCCCCTGCTGC ... the following: cycle of 94 C for min; 20 cycles of 94 C for 30 s, 53 C for 30 s and 72 C for 90 s; cycle of 72 C for 10 The primers were removed using the peqLab PCR cycle pure kit The extracted...
  • 135
  • 365
  • 0
Gián án Test yourself c, review for the first term

Gián án Test yourself c, review for the first term

Ngày tải lên : 28/11/2013, 11:11
... then write - Compare the results with the other groups - Correct mistakes - Study all the lessons again + to study all the lessons again date of teaching Class 1 2C2 Absent student 1 2C3 1 2C4 The ... words they have just heard - Go round the class to control the work - Then turn on the tape of the passage the last time for students to check their results - Correct mistakes II Reading ... in the past 3- to emphasize the sequence of action at a period of time 4- for a progressive action interrupted by another simple past action - T summarize the content of the lesson + use and form...
  • 15
  • 917
  • 0
Tài liệu Writing C Code for the 8051 pptx

Tài liệu Writing C Code for the 8051 pptx

Ngày tải lên : 20/01/2014, 02:20
... driver circuit Interface the PC to the 8051 through a serial communication link Control the movement of the stepper motor by characters received from the PC • When the character 'l' is received ... between the PC and the 8051 Description: Serial communication is often used either to control or to receive data from an embedded microprocessor Serial communication is a form of I/O in which the ... example in the Datasheet to connect the ADC0804 The LCD can be connected as was done in the earlier labs Figure Connection Diagram Figure Typical Applications Figure A/D Schematic Program: #include...
  • 52
  • 535
  • 1
Báo cáo khoa học: Unique proteasome subunit Xrpn10c is a specific receptor for the antiapoptotic ubiquitin-like protein Scythe docx

Báo cáo khoa học: Unique proteasome subunit Xrpn10c is a specific receptor for the antiapoptotic ubiquitin-like protein Scythe docx

Ngày tải lên : 30/03/2014, 11:20
... Xrpn1 0c- speci c region was necessary and sufficient for Scythe binding (Fig 4B ,C, D) The most critical region for Scythe binding in Xrpn1 0c was the C- terminal region containing amino acids 331–339 (Fig 4C, D), ... 10cbox (Fig 1C) , the sequences of which are conserved across species Deletion of this sequence largely abolished Scythe binding (Fig 4B ,C, D) To evaluate precisely the contribution of the 1 0c- box ... sequence for Scythe binding, we quantified the relative strength of immunosignals of 1 0c- box-lacking forms of Xrpn1 0c compared with 1 0c- box-including forms The signal of Xrpn1 0c (1–330) decreased...
  • 14
  • 279
  • 0