... Lanzhou 730070, China E-mail address: mary@maths.uq.edu.au Yulian An: Physical Software & Engineering, Lanzhou Jiaotong University, Lanzhou 730070, Gansu, China E-mail address: an yulian@tom.com ... solutions for a nonlinear differential equation with nonlinear boundary conditions, Ann Polon Math 69 (1998), no 2, 155–165 L Erbe and M Tang, Structure of positive radial solutions of semilinear elliptic ... elliptic equations on annular domains, Nonlinear Anal Ser A: Theory Methods 44 (2001), no 6, 749–758 J Henderson and H Y Wang, Positive solutions for nonlinear eigenvalue problems, J Math Anal Appl...
... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... tip of the red, positive lead on the positive side ofa battery Put the tip of the black, negative, lead on the other end ofa battery a Is any number showing up on the multimeter? _If not, make ... Name one important function ofa multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3.0 - Lab 3.1.1 Copyright...
... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... tip of the red, positive lead on the positive side ofa battery Put the tip of the black, negative, lead on the other end ofa battery a Is any number showing up on the multimeter? _If not, make ... Name one important function ofa multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3.0 - Lab 3.1.1 Copyright...
... Stutz 1996 Bayesian classification (AutoClass): Theory and results In Fayyad, Piatetsky-Shapiro, Smyth, and Uthurusamy, editors, Advances in Knowledge Discovery and Data Mining AAAI Press/MIT ... Kappa values, and raises the average agreement among the judges to a Kappa value of over 0.87 for the sentences that can be tagged with certainty Using only simple features, the classifier achieves ... including AutoClass (Cheeseman and Stutz, 1996) The form of the latent class model is that of naive Bayes: the observed variables are all conditionally independent of one another, given the value of...
... AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGGCAAAGAGTTTCTCAGGGAAACT 64 TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG ... -GTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAGAAAGGTGGCGGCT || |||||| || | |||||| |||||||||||||| || |||||||| || ||||||| 1723 CGT-GTACGTAGGAAACAACAACGAATACCGCATCAGCCTGGCCAAGAAGGGCGGCGGCT 301 302 GTCCC-GTGATGAACCTGCACGCCGAATACAC-CACTTCGTTTGA-GAGTTTCATCGACA ... CCGTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAG P S Y V G T N N E Y R I S L A K AAAGGTGGCGGCTGTCCCGTGATGAACCTGCACGCCGAATACACCACT K G G G C P V M N L H A E Y T T TCGTTTGAGAGTTTCATCGACAAGGTGATATGGTACAACTTTTACAAG S F E...
... using alternating surface-saturating reactions of titanium chloride and water The TiOPDA-TiO2 nanohybrid thin films that were prepared exhibit good thermal and mechanical stability, large-scale ... binding energy scale was calibrated to 284.5 eV for the main C 1s peak Each sample was analyzed at a 90° angle relative to the electron analyzer The samples were analyzed by a JEOL2100F transmission ... thermal and mechanical stability Experimental details Preparation of Si substrates The Si (100) substrates used in this research were cut from p -type (100) wafers witha resistivity in the range of...
... control, and some exponential stability criteria are established Finally, some conclusions and remarks are drawn in Section Problem Formulation and Preliminaries Consider aclassof nonlinear uncertain ... We use P > < 0, ≤ 0, ≥ to denote a positive negative, seminegative, and semipositive definite matrix P Journal of Inequalities and Applications Exponential Stabilization ofaClassof Uncertain ... Journal of Inequalities and Applications 1, are real constant matrices of appropriate dimensions and F t is an where Di , Ei , i unknown time-varying matrix with F T t F t ≤ I The following lemmas...
... using alternating surface-saturating reactions of titanium chloride and water The TiOPDA-TiO2 nanohybrid thin films that were prepared exhibit good thermal and mechanical stability, large-scale ... binding energy scale was calibrated to 284.5 eV for the main C 1s peak Each sample was analyzed at a 90° angle relative to the electron analyzer The samples were analyzed by a JEOL2100F transmission ... thermal and mechanical stability Experimental details Preparation of Si substrates The Si (100) substrates used in this research were cut from p -type (100) wafers witha resistivity in the range of...
... 1199–1214, 2005 H Wenhua, “Minimax theorems and applications to the existence and uniqueness of solutions of some differential equations,” Journal of Mathematical Analysis and Applications, vol 322, ... each eigenvalue is repeated according to its multiplicity If A commutes with B, that is, AB BA, then A B is a diagonalization matrix and μ1 λ1 ≤ μ2 λ2 ≤ · · · ≤ μn λn are the eigenvalues ofA ... this paper to achieve their research References S A Tersian, A minimax theorem and applications to nonresonance problems for semilinear equations,” Nonlinear Analysis: Theory, Methods & Applications,...
... Problems Y Ling and S Ding, Aclassof analytic functions defined by fractional derivation,” Journal of Mathematical Analysis and Applications, vol 186, no 2, pp 504–513, 1994 D Delbosco and L Rodino, ... metric spaces,” Journal of Mathematical Analysis and Applications, vol 341, no 2, pp 1241–1252, 2008 13 AA Kilbas and J J Trujillo, “Differential equations of fractional order: methods, results and ... problems—I,” Applicable Analysis, vol 78, no 1-2, pp 153–192, 2001 14 S G Samko, AA Kilbas, and O I Marichev, Fractional Integrals and Derivatives Theory and Applications, Gordon and Breach Science,...
... general classof variational inclusions,” Journal of Mathematical Analysis and Applications, vol 201, no 2, pp 609–630, 1996 C Baiocchi andA Capelo, Variational and Quasivariational Inequalities: Applications ... Siddiqi and Q H Ansari, “Strongly nonlinear quasivariational inequalities,” Journal of Mathematical Analysis and Applications, vol 149, no 2, pp 444–450, 1990 22 A H Siddiqi and Q H Ansari, “General ... Theory and Applications algorithm, and obtained the existence of solutions for aclassof variational inclusions and convergence of the iterative algorithm In 2004, Liu and Kang 19 established...
... [8] to a broader classof channels (3) We also investigate aclassof parallel multireceiver wiretap channels with two subchannels, two users, and one eavesdropper, see Figure For the channels ... model, we again have a parallel multireceiver wiretap channel with two subchannels, two users, and one eavesdropper, and the degradation order in each subchannel is exactly the same as in the ... message secrecy capacity for a special classof parallel multireceiver wiretap channels was studied in [8] In this classof parallel multireceiver wiretap channels [8], each subchannel exhibits a...
... 139–164, 1978 J L Kaplan and J A Yorke, “Ordinary differential equations which yield periodic solutions of differential delay equations,” Journal of Mathematical Analysis and Applications, vol 48, ... is a periodic solution of 1.2 with period T 2.20 2π Journal of Inequalities and Applications Acknowledgments The authors would like to thank the referee for careful reading of the paper and many ... solutions, and stability of solutions, have been studied by many authors since 1970s of the last century, anda lot of remarkable results have been achieved We refer to 1–6 for reference The delay equation...
... Banach Space and Nonlinear Partial Differential Equations, vol 49 of Mathematical Surveys and Monographs, American Mathematical Society, Providence, RI, USA, 1997 Jianhua Huang: Institute of Mathematics ... [2] M A Noor, “On aclassof variational inequalities,” Journal of Mathematical Analysis and Applications, vol 128, no 1, pp 138–155, 1987 [3] S S Zhang and S W Xiang, “On the existence and uniqueness ... uniqueness of solutions for aclassof variational inequalities with applications to the Signorini problem in mechanics,” Applied Mathematics and Mechanics, vol 12, no 5, pp 401–407, 1991 [4] K.-Q Wu and...
... 137–152 [8] T Tanigawa and W Fentao, On the existence of positive solutions for aclassof even order quasilinear differential equations, Advances in Mathematical Sciences and Applications 14 (2004), ... (Russian) [2] T Kusano and B S Lalli, On oscillation of half-linear functional-differential equations with deviating arguments, Hiroshima Mathematical Journal 24 (1994), no 3, 549–563 [3] T Kusano and ... Department of Mathematics and Computer Science, Faculty of Science and c Mathematics, University of Niˇ, Viˇegradska 33, 18000 Niˇ, Serbia and Montenegro s s s E-mail address: jelenam@pmf.ni.ac.yu...
... advancing borders and muscular involvement, subcutaneous air, and undermining of the epidermis [14] Also, surgery and pathology indicated intact fascial plains with edema, and the absence of ... collaboration, no alternative diagnosis applied to our patient We reiterate that amputation in this scenario was an unfortunate and Page of debilitating last resort once all therapeutic modalities ... list, and created the tables JM wrote the abstract, case presentation and discussion and conducted journal and literature research SZ reviewed the case presentation and added to the treatment of...
... that was linked to the general tasks and demands category (D2302) from chapter 2, general tasks and demands and an item linked to remunerative employment (D850) Oude Voshaar et al Health and ... 0.60) with other measures of PF and measures of other aspects of physical health and moderately (0.30
... development and used ofa telephone questionnaire designed to measure the severity of AOM and its consequences on the QOL of the child andof the caregiver and its use in a country-wide survey in Canada ... six domains The OM-6 also contains a visual analog scale of happy and sad faces allowing the caregiver to rate their child QOL on a 10-point scale This was Descriptive statistics were generated ... between children with severe AOM, (i.e AOM that lasted ≥ days and had ≥ related-symptoms, n = 56) and children with less severe AOM, (i.e AOM that lasted ≤ days and had ≤ related-symptoms, n...
... and adjusted Cy5 intensities as technical replicates and calculated the mean of these values The ratio of this mean on the average of the intensity across the array set was then obtained A ratio ... using a human genomic β-actin calibration curve Absolute viral and β-actin DNA copy number was assessed and final viral DNA load per 106 cells was calculated by the following formula: [HHV-6 DNA ... National Institutes of Health (NIAID/NIH) to Fatah Kashanchi Fatah Kashanchi and Steve Jacobson share senior authorship 18 19 20 21 References Hegde P, Qi R, Abernathy K, Gay C, Dharap S, Gaspard...