use financing as a tool to change mental health service delivery systems
Báo cáo y học: "Use of facility assessment data to improve reproductive health service delivery in the Democratic Republic of the Congo" pdf
... Women and men affected by armed conflict have the right to RHrelated information and access to safe, effective, affordable and acceptable FP methods as well as appropriate and effective health care ... http://www.conflictandhealth.com/content/3/1/12 Parenteral antibiotics Parenteral uterotonics Parenteral anticonvulsants Manual removal of placenta Removal of retained products Assisted vaginal delivery Neonatal resuscitation Blood transfusion ... FP and EmOC services and was consistently ranked as the main reason that facilities did not provide RH services For example, none of the nine hospitals was able to perform an assisted vaginal delivery...
- 12
- 306
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products...
- 12
- 616
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
... those measures that are being used in the target areas as well as foreign countries, such as Indonesia, China, Bangladesh, Germany, Mexico, Colombia, USA. Some of them are introduced as follows. ... Table 7. Standardized score for costs of combinations Measure A1 +A2 .3 A1 +B1 A1 +B2 A1 +B1+B2 A2 .1 +A2 .3 A2 .1+B1 A2 .2 +A2 .3 A2 .2+B1 A2 .3+B1 A2 .3+B1+B2 Standardized cost Standardized score ... objectives and requirements of related factors, as well as the alternatives that have been used in the study area. From that it suggests the measures to solve the problems and apply the MCA approach for selecting the most suitable ...
- 13
- 487
- 0
Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt
... relevant case reports and literatures are also indicated in the Ishikawa diagram so that readers can retrieve the case reports and relevant literatures easily The potential causes for secondary amenorrhea/oligomenorrhea ... diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching medical students and ... Journal of Obstetrics and Gynaecology, which has substantiated information about ovarian cancers and amenorrhea [8] In this way, continually organizing and updating information on an Ishikawa diagram...
- 3
- 381
- 0
Báo cáo khoa học: "Hyperglycaemic index as a tool to assess glucose control: a retrospective study" docx
... that possess a patient database management system that can provide automated input for the HGI calculation The fact that HGI expresses glucose regulation as a single value has methodological advantages ... mean age was 55 years (standard deviation 19 years) and 65% were male Table lists the demographical data and glucose-related measures for survivors and nonsurvivors APACHE II scores were available ... were obtained from the central laboratory database Therapeutic protocol Patients were fed enterally as soon as possible Total parenteral nutrition was only given when enteral nutrition failed Concentrated...
- 6
- 264
- 0
Báo cáo y học: " Factor correction as a tool to eliminate between-session variation in replicate experiments: application to molecular biology and retrovirology" ppsx
... Figure A: original data B: normalised data C: standardised data D: data after factor correction Note that normalisation, standardisation, and factor correction reduce the variation within each condition ... approach assigns part of the variation to the estimated session factors The ratio approach can be seen as a special case, in which the user assumes that the multiplicative factor is the same for ... multiplicative session factors When known, these factors can be used to correct the data As was demonstrated in the previous paragraphs, normalisation and standardisation both use correction factors...
- 8
- 304
- 0
Báo cáo hóa học: " The Armeo Spring as training tool to improve upper limb functionality in multiple sclerosis: a pilot study" ppt
... end-effector robots as assessment tools for quantifying motor coordination in (a) symptomatic MS patients during the execution of robotic tasks (e.g reaching tasks towards virtual targets on a screen) [14,15] ... Because assumptions of normality were not always fulfilled, and because of the modest sample size, the non-parametric Wilcoxon signed-rank test was implemented to appraise changes in outcome measures ... technology enables stimulating as well as cost-effective practice, since it can be performed on a relatively autonomous and additional basis, also by a more disabled patient population as the one in the...
- 8
- 678
- 0
Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc
... self-assessment tool 'Is research working for you? A self-assessment tool and discussion guide for health services management and policy organizations' was developed by the Canadian Health Services ... an area, about what the current position on an issue was, and what was seen as best practice Assess Participants identified a general lack of skills around assessing the research Those organizations ... distinctions that the tool makes in relation to these four areas are important to identify The tool can serve as a catalyst for an important discussion about research use; such a discussion, in and of...
- 9
- 506
- 0
báo cáo khoa học: " Masculinity as a barrier to men’s use of HIV services in Zimbabwe" potx
... informed and their Skovdal et al Globalization and Health 2011, 7:13 http://www.globalizationandhealth.com/content/7/1/13 peers as fearful and ‘ignorant’, male ART users are able to create a distance ... feminine traits, then what are simultaneously obstacles to men may well be facilitators to women Having said this, women’s continued marginalisation, as well as many social and povertyrelated factors ... extra-marital sexual relationships and gets an embarrassing disease like HIV is perceived to have a weak, diseased, compromised, laughable and despicable sexuality - compromising his manhood Relatedly,...
- 14
- 603
- 0
báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf
... self-assessment tool 'Is research working for you? A self-assessment tool and discussion guide for health services management and policy organizations' was developed by the Canadian Health Services ... an area, about what the current position on an issue was, and what was seen as best practice Assess Participants identified a general lack of skills around assessing the research Those organizations ... distinctions that the tool makes in relation to these four areas are important to identify The tool can serve as a catalyst for an important discussion about research use; such a discussion, in and of...
- 9
- 412
- 0
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza A ... effective measure we have to combat influenza is isolation and culling of infected fowls as demonstrated by the government of China, Vietnam, and Thailand As human populations continue to increase and ... happen to the influenza when it went to France The first theory that was offered was that this “Spanish flu” was actually a different disease Decades later phylogenic testing will find this to...
- 4
- 520
- 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly
... samples was created by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes were evaluated on a 9-point scale that was ... pleasantness ratings, the aroma concentration had a similar effect on both age groups in the first tasting session: the heightened aroma sample was rated as less pleasant than the regular aroma sample ... home -use) Age group (two levels) was used as a between-subject factor These statistical analyses were also conducted with gender as a betweenfactor to examine its effect No trend towards the main...
- 10
- 599
- 1
Using eliciting question as a technique to teach english to 11th form pupils
... also be used to help pupils understand the whole text such as a funny story Example: A tourist visiting a pub was fascinated by a stuffed lions head mounted on a mahogany plaque above a door behind ... play a very important role in every classroom Teachers can create an active learning environment by encouraging students to ask and answer questions Some ideas to make student questions and teacher ... emphasizing less important material Phrase your questions carefully - Phrase your questions so that the task is clear to students Questions such as What about foreign affairs? not often lead to...
- 42
- 641
- 0
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt
... Q279E a- galactosidase A residual activity in patient derived cells; thus, galactose was demonstrated to be first active-site-directed pharmacologic chaperone for a lysosomal storage disease Galactose ... ameliorate Gaucher disease 19 Fan JQ, Ishii S, Asano N & Suzuki Y (1999) Accelerated transport and maturation of lysosomal alpha-galactosidase A in Fabry lymphoblasts by an enzyme inhibitor Nat Med ... a- galactosidase A variants (causing another lysosomal storage disease) were shown to be folding and trafficking mutants [16] before this was explored as a possibility in GD Galactose administration increased...
- 7
- 507
- 0
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx
... differentially based on varying stabilities Remarkably, we have found that, at least in some circumstances, a quantitative correlation to biophysical data can be obtained from a statistical analysis of ... camelid heavy chain antibody scaffold for use in constructing naı¨ ve antibody libraries [15] Here, the association of the variable heavy chain (VH) with protein A was used as a surrogate for direct ... irrational, but that can be rapidly explored using a phage selection Design of a heavy chain antibody scaffold A conceptually similar approach was employed by Bond et al in the design of a camelid...
- 7
- 502
- 0
Tài liệu Using Proven Sales Techniques for Selling WorkKeys as a Solution to Business doc
... fiery keep guarded by a dragon in order to clear out his swamp of menacing fairytale creatures An indomitable Southern belle loves and loses and loves again a slyly dashing war profiteer as she struggles ... because you get your work done quickly You like to sugarcoat unpleasant experiences and rationalize bad situations into good ones You have a propensity towards narcotic addiction Twisted Apart, ... friendly manner, graciously and courteously • That you want to help them • To see you as the solution to their problem, and not be seen as your problem • To be treated as mature adults, not as children...
- 48
- 482
- 0
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc
... content This quantitative change was accompanied by qualitative modification, as the methyl/methylene CH3/CH2 ratio was found to increase significantly in these cells A nuclear magnetic resonance study ... et al assigned the shoulders present at 1117 and 1020 cm)1 to RNA and DNA, respectively [18] Classification by LDA Classification by LDA on spectra reduced by PCA PCA was performed on the training ... cell spectrum and spectral areas selected by genetic algorithm A smear of about · 105 cells was dried on an area of cm2 on the germanium surface as explained in Materials and methods Wavenumbers...
- 6
- 555
- 0
Business water footprint accounting: A tool to assess how production of goods and services impacts on freshwater resources worldwide pdf
... study on the Zambezi basin A. K Chapagain − February 2000 Water value flows: A case study on the Zambezi basin A. Y Hoekstra, H.H.G Savenije and A. K Chapagain − March 2000 The water value-flow concept ... Netherlands A. Y Hoekstra and A. K Chapagain – July 2006 22 Water’s vulnerable value in Africa P van der Zaag – July 2006 23 Human appropriation of natural capital: Comparing ecological footprint and water ... Seyam and A. Y Hoekstra − December 2000 The value of irrigation water in Nyanyadzi smallholder irrigation scheme, Zimbabwe G.T Pazvakawambwa and P van der Zaag – January 2001 The economic valuation...
- 46
- 959
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA ... AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT ... enhance PYM-induced caspase activation and subsequent PARP cleavage (F) Effect of CA9 ASO on PYM-induced caspase activation on Tca8113 ⁄ PYM cells The relative activation of caspase shown was calculated...
- 13
- 563
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25