upon arrangement of the debt or loan for the amount received less any transaction costs generally with a debit to accounts in subgroup 57

Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

Ngày tải lên : 20/06/2014, 01:20

... AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3' GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGGAAATGTTGAATACTCA TACTCTTCCTTTTTC-3' The linear PCR-generated fragments were electroporated into YEbac102, an E ... (5'gatttcgcgcaggtgatgag-3') for UL8; and 18S rRNA-f (5'-actcaacacgggaaacctca-3') and 18S rRNA-r (5'-aaccagacaaatcgctccac-3') for 18S rRNA Reactions were performed using SYBER Premix Ex Taq II (Takara) with the Thermal ... amplifications were performed with primers UL6-f (5'-aaattctgtgtcaccgcaacaac-3') and UL6-r (5'-gcccgaagcactgactcaa-3') for UL6; UL8-f (5'-cttgctggacgcagagcacta-3') and UL8-r (5'gatttcgcgcaggtgatgag-3')...

13
463
0

Báo cáo sinh học: "Probability statements about the transmitting ability of progeny-tested sires for an all-or-none trait with an application to twinning in cattle" pptx

Ngày tải lên : 14/08/2014, 20:20

... ( and A is calculated for methods II and III according to formula (20) As a matter of fact, methods I, II III can be compared only when using the same amount of information, v.i.z the same n and ... D )a; , Notice that k can be interpreted as in selection index theory as the ratio of a within sire to a sire variance, since p(l - p)/(p2(.) is the asymptotic variance of the normit transformation ... in asymptotic theory (see for instance, formula 6a. 23, page 386 in Rao, 1973) and knowing that: is also one has, given Assuming to a i a as in section II B that, a priori, the f-Li’S i -L f with...

18
313
0

Segmentation of the oral and facial regions from imaging modalities with reduced or no ionizing radiation

Ngày tải lên : 10/09/2015, 09:32

... would also like to thank Mr Francis Hoon, laboratory of cer at vision and machine learning laboratory, for his assistance during my Ph.D study Special thanks to my friends and colleges in the lab ... visualize the surface of the crown of the tooth In recent years, however, the availability of more powerful medical imaging machines has brought the diagnostic oral and maxillofacial imaging ... assign a label of tissue to any pixel in a medical image, where the labels are selected in advance according to the medical applications In the case of tooth segmentation, the classes could be tooth,...

178
296
0

Tài liệu Báo cáo khoa học: Post-translational modiﬁcation of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx

Ngày tải lên : 16/02/2014, 15:20

... its ability to stabilize the active form of RhoA prior to invasion YpkA and OTUB1 modulate the stability of RhoA in opposing ways, therefore leading to cytoskeletal rearrangements that may be involved ... susceptibility to invasion, we used Yersinia strains that either had mutations in the kinase (ypkAD27 0A) or GTPase-binding domain (Yersinia contact A mutant strain) [18] OTUB1-mediated susceptibility to invasion ... OTUB1, as a 37 kDa polypeptide, was also found in a complex with the inactive kinase mutant YpkA D26 7A (Fig 3A) Third, invasion with the Yersinia mutant strain expressing an inactive YpkA kinase...

16
654
0

Tài liệu Báo cáo Y học: Proteolysis of bovine b-lactoglobulin during thermal treatment in subdenaturing conditions highlights some structural features of the temperature-modiﬁed protein and yields fragments with low immunoreactivity pptx

Ngày tải lên : 21/02/2014, 15:20

... simplicity of the approaches described above, heat denaturation and aggregation of BLG upon heat treatment may hide putative sites of attack from the action of proteases, therefore leaving intact some ... connects to the leftovers of strand D via a disulﬁde bridge to Cys66 [5] As stated in the introduction, one of the goals of this work was to take advantage of the interplay of treatment conditions and ... phosphate buffer, pH 6.8) to a ﬁnal mass ratio enzyme/BLG of : 20 or of : 10 The protein/protease mixture was then placed in a thermostatted water bath for the required amount of time At the end of...

11
526
0

Báo cáo khoa học: The Saccharomyces cerevisiae orthologue of the human protein phosphatase 4 core regulatory subunit R2 confers resistance to the anticancer drug cisplatin pot

Ngày tải lên : 07/03/2014, 12:20

... CATAGTGGAAAGAGGGATATAAATTATCGCATAAAACAATAAACAAAAAGAAAAATG AGGGAACAAAAGCTGGAG GGGAGTCAGCTGTTCGGTAACAGCATCTTGCATAGGCACATCTAAATCTGTATCCTGTAGGGCGAATTGGG GCAAAGTAAAACAGCACGAAAAAAGTGATTACAAATTTCAAGGGAGATATGATGAGGGAACAAAGGCTGGAG ... GGCAATTGGAGTGACATAGCAGCTACTACAACTACAAAAGCAAAATCTCCACAAAGTAAT CGGATCCCCGGGTTAATTAA CCAAGTGCTTCAATCCTAGAGAAGAAGAAAGGTAAGAAAAAGAAAGGAAAGCAACTTAAT GAATTCGAGCTCGTTTAAAC pFA 6a- HIS3MX6 pFA 6a- HIS3MX6 pFA 6a- 13Myc-HIS3MX6 ... GTAACTTCAGGTAGTAACTGGGCCTTGTATAGCCTTTCTAAACATTCGTCCAACTGTAGGGCGAATTGGG GAAATACTATTGAAGCTCAAAAACATCCATAATAAAAGGAACAATAACAATGGTAAGGGAACAAAAGCTGGAG GCGCCTGGCATTTCTTTATTGTTTCAAGCCATTCGTCGGGGCCTCTAGACTGTAGGGCGAATTGGG GGCAATTGGAGTGACATAGCAGCTACTACAACTACAAAAGCAAAATCTCCACAAAGTAAT...

13
389
0

Báo cáo khoa học: Catalytic mechanism of the primary human prostaglandin F2asynthase, aldo-keto reductase 1B1 – prostaglandin D2 synthase activity in the absence of NADP(H) pptx

Ngày tải lên : 14/03/2014, 23:20

... protein (A) Autoradiogram of TLC after incubation of AKR1B1 (each 10 lg protein) with lM 1-[14C]PGH2 in the presence or absence of cofactor at 37 °C for at pH 7.0 with or without heat treatment at ... presence of 0.5 mM NADPH for PGFS activity (s) or in the absence of NADPH or NADP+ for PGDS activity (d) at 37 °C for PGH2 conversion to PGD2 or PGF 2a was analyzed by TLC and autoradiography The corresponding ... Nagata N, Maruyama T, Shimamoto S & Urade Y (2009) Biochemical, functional, and pharmacological characterization of AT-56, an orally active and selective inhibitor of lipocalin-type prostaglandin...

11
390
0

REGULATION OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL on European Social Entrepreneurship Funds (Text with EEA relevance) docx

Ngày tải lên : 23/03/2014, 08:21

... European Parliament and the Council23 or in accordance with national law in relation to the EuSEF, the information referred to in paragraph of this Article may be provided either separately or as a ... the investors in that other EuSEF EuSEF managers shall maintain and operate effective organisational and administrative arrangements in order to comply with the requirements laid down in paragraph ... direct or indirect offering or placement at the initiative of the EuSEF manager or on behalf of that manager of units or shares of a EuSEF 20 EN it manages to or with investors domiciled or with a...

31
412
0

Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt

Ngày tải lên : 23/03/2014, 20:22

... DNA-binding domain in an active conformation RLjunRP is an 40 kDa protein that forms an 80-kDa protein–DNA adduct To assess approximate molecular mass of the factors interacting with the )148 to )124 ... acrylamide) and analysed by autoradiography changes of · binding buffer over a period of 30 and autoradiographed Afﬁnity puriﬁcation of the factor(s) interacting with the )148 to )124 region of ... Phosphatase-treated nuclear extracts were assayed for their DNA-binding capacity in standard EMSA UV crosslinking of DNA–protein adduct The EMSA reaction was carried out using ng labelled Jun)25 and...

9
449
0

Báo cáo Y học: Cloning and characterization of the mammalian-speciﬁc nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein doc

Ngày tải lên : 23/03/2014, 21:20

... under accession AJ437692 Further analyses were performed with the online tools of the European Bioinformatics Institute (http:// www.ebi.ac.uk/), BLAST database searches in the GenBank database of ... of the cDNAs in the used panels is normalized to four different housekeeping genes The PCR analyses of the panels was carried out according to the manufacturer’s instruction For the human and ... These data provide strong evidence for a nuclear localization of nicolin regardless of the mode of fusion with the GFP (i.e N- or C-terminal) Apparently the fusion of GFP had no substantial in uences...

6
450
0

Báo cáo khoa học: Spectroscopic and DNA-binding characterization of the isolated heme-bound basic helix–loop–helix-PAS-A domain of neuronal PAS protein 2 (NPAS2), a transcription activator protein associated with circadian rhythms docx

Ngày tải lên : 30/03/2014, 11:20

... suggests that the bHLH domain plays an important role in assisting and stabilizing heme binding to the PAS -A domain in the isolated bHLH-PAS -A domain of NPAS2 The QCM data indicated that the isolated ... properties of NPAS2 The rate constant for heme association (kon) with the isolated bHLH-PAS -A domain of NPAS2 was of the same order as those for heme association with the heme-regulated kinase inhibitor ... understand the heme-binding character of the bHLH-PAS -A domain, we examined the association rate constants (kon) for binding of the Fe(II)–CO heme complex to the apo-bHLH-PAS -A and apo-PAS -A domains of...

12
360
0

ANNUAL REPORT OF THE GREAT LAKES REGIONAL WATER USE DATABASE REPOSITORY REPRESENTING 2006 WATER USE DATA IN GALLONS docx

Ngày tải lên : 30/03/2014, 22:20

... year’s water use data in the fall to states and provinces All data are submitted to the repository in a Microsoft Excel or Access format then compiled into a single Microsoft Access database All ... sources for irrigation and livestock data As no viable source of current data is available for industrial water use, the reported industrial data are from 1996 Data for the power sector categories ... generation), in addition to new features such as a flexible data interface and automatic data checking A Great Lakes Regional Water Use Database to provide comparable water use information on withdrawals,...

111
290
0

Báo cáo khoa học: A dimer of the FeS cluster biosynthesis protein IscA from cyanobacteria binds a [2Fe2S] cluster between two protomers and transfers it to [2Fe2S] and [4Fe4S] apo proteins ppt

Ngày tải lên : 31/03/2014, 01:20

... et al (Eur J Biochem 270) Incorporation of the FeS cluster into IscA1 and variants Incorporation of the FeS cluster into IscA1 and variants was achieved by incubating IscA1 (concentration range: ... thaliana IscA1) AC007067.4, P_purp (Porphyra purpurea) NP_053827, Athal2 (Arabidopsis thaliana IscA2) AC005825.3, Athal3 (Arabidopsis thaliana IscA3), AC006921.5, A_ vinIscA (Azotobacter vinelandii ... thaliana and the red algae Porphyra purpurea According to a prediction using the computer program TARGET P the Arabidopsis protein is localized in the chloroplast In Porphyra purpurea the protein...

10
447
0

báo cáo sinh học:" Narrowing the gap between eye care needs and service provision: a model to dynamically regulate the flow of personnel through a multiple entry and exit training programme" pdf

Ngày tải lên : 18/06/2014, 17:20

... Figure and Training6 workforce flow for the non-physician sector of eye care personnel Training and workforce flow for the non-physician sector of eye care personnel and interacts with its immediate ... trained clinical officers Figure Entrants4into Stage training Entrants into Stage training The proposed training system is based on the notion that all practitioners within eye care be trained ... the stages without failure or leaving; that all existing industry workers enter the workforce at the end of each stage of training and entrants after 2018 must progress to stage In scenario after...

6
442
0

báo cáo hóa học: " Cultural adaptation into Spanish of the generalized anxiety disorder-7 (GAD-7) scale as a screening tool" pot

Ngày tải lên : 18/06/2014, 19:20

... on the number of factors contained in the solution A confirmatory factor analysis [31,32] was also performed to corroborate the original structure, assuming the existence of one single factor ... translators and sent to the original authors for conceptual equivalence assessment Once piloted, the final version was included in a Case Report Form (CRF) for administration to the scaling and validation ... quartiles based on the GAD-7 total score and comparing the upper to the lower quartile, both for the mean scores in individual items and for the overall score For other clinical criteria, validity...

11
537
0

báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc

Ngày tải lên : 18/06/2014, 19:20

... pre-testing to check for errors or problems The data collectors were all fluent in Luo and English A final forward and back-translation was then produced and a final review conducted by the study team ... Boas MHA: Northern Uganda IDP Profiling Kampala: UNDP/ GoU/FAFO; 2005 Internally Displaced Camps in Lira and Pader, Northern Uganda A Baseline Health Survey Preliminary Report [http://www.msf .or. jp/news/baseline/Baseline.pdf] ... Acknowledgements Assistance with data for the sample frame was provided by the World Food Programme (Gulu Office) and the International Organisation for Migration (Gulu Office) This work was supported by the...

10
647
0

Response of the Affected Agency Comments on Agency Response We transmitted a draft of this report potx

Ngày tải lên : 18/06/2014, 20:20

... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ...

5
157
0

báo cáo hóa học:" Existence of positive solutions for fourth-order semipositone multi-point boundary value problems with a sign-changing nonlinear term" docx

Ngày tải lên : 21/06/2014, 17:20

... Acknowledgments The author is very grateful to Editor of the Journal and the anonymous referees for their carefully reading of the ﬁrst draft of the manuscript and making many valuable suggestions 22 and ... index theory in cone and constructing some available integral operators together with approximating technique They guarantee the existence of at least one positive solution for nonlinear fourth-order ... main results The proof of the main results will be stated in Section A class of examples are given to show that our main result is applicable to many problems in Section Preliminaries and lemmas...

25
221
0

Báo cáo lâm nghiệp: " Changes of the mixed mountain virgin forest after 70 years on a permanent plot in the Ukrainian Carpathians" pps

Ngày tải lên : 07/08/2014, 10:22

... transformed according to van der Maarel (2005) To estimate the influence of environmental factors, the eigenvalues of the corresponding ordination axes from unconstrained (PCA) and constrained ... eigenvalues of the first ordination axes from PCA and RDAtime shows that about 90% of the vegetation variability along the main floristic gradient can be attributed to temporal change (Tables and ... shows the spatial localization of relevés in temporal change data – supplementary variables (time) show the main direction of temporal change in relation to the relevé localization RDAtime scatterplot...

11
303
0

Báo cáo khoa học: "Does the surgeon still have a role to play in the diagnosis and management of lymphomas?" docx

Ngày tải lên : 09/08/2014, 07:21

... lymphoma incidence in Wales with a ratio of 1:4 [1] Table 1: Anatomical location of lymphomatous lymph nodes (n = 62) Anatomical location Number of cases Cervical Inguinal Axillary Intra-abdominal ... lymphomas, in particular HL, was stimulated by a report from Stanford University in the late 1960s which showed that the performance of a staging laparotomy altered the stage of disease in 42% of cases, ... half of the cases although this was performed in 81% of head and neck lymphadenopathy in accordance with practice guidelines [4] The importance of performing an FNAC in patients with cervical...

4
435
0