update a primary key value in sql

Tài liệu Updating a Primary Key Value pdf

Tài liệu Updating a Primary Key Value pdf

Ngày tải lên : 26/01/2014, 10:20
... Updating a Primary Key Value Problem You changed a primary key value in a DataTable and updated the change back to the underlying data source, but the value in the data source remained unchanged. ... called. To change the primary key in the table in the database, the UpdateCommand of the DataAdapter needs to locate the row based on the original primary key and update the primary key value ... need to update a primary key value in the data source underlying the DataTable. Solution Use the SourceVersion property of SqlParameter to update the primary key value in the data source....
  • 5
  • 273
  • 0
Tài liệu Define a Primary Key and Other Indexes docx

Tài liệu Define a Primary Key and Other Indexes docx

Ngày tải lên : 14/12/2013, 20:16
... 2.3 Define a Primary Key and Other Indexes Indexes are used to improve performance when querying data, such as searching on fields and sorting information. The primary key is an index that ensures ... hurt performance when adding and updating data. This is mainly true when importing or adding large amounts of data. The other point is that when the table is small, you can over-index as well. ... create a field that is automatically incremented, called an identity field. This identity field can also be set as the primary key field, again so that the record is made unique. The primary key...
  • 5
  • 383
  • 0
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Ngày tải lên : 24/12/2013, 01:17
... made in the child DataTable. This is the default. None Indicates that no action takes place. SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in ... you change the DataColumn in the parent DataTable on which the ForeignKeyConstraint was created, then the same change is also made in any corresponding DataRow objects in the child DataTable. ... type are shown in Table 12.4 . Table 12.4: Rule ENUMERATION MEMBERS CONSTANT DESCRIPTION Cascade Indicates that the delete or update to the DataRow objects in the parent DataTable are also made...
  • 6
  • 428
  • 0
Tài liệu Adding Records with a GUID Primary Key pdf

Tài liệu Adding Records with a GUID Primary Key pdf

Ngày tải lên : 21/01/2014, 11:20
... be changed after each row is added to the table so that each row has a different GUID primary key value. This is done by handling the RowChanging event for each table. When a row has been added, ... DataRowChangeEventHandler(parentTable_RowChanging); childTable.RowChanging += new DataRowChangeEventHandler(childTable_RowChanging); } private void parentTable_RowChanging(object sender, DataRowChangeEventArgs ... The RowChanging event of the DataTable is raised when a DataRow is changing. The action that occurred on the row can be determined by the Action property of the DataRowChangingEventArgs argument...
  • 4
  • 340
  • 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Ngày tải lên : 19/02/2014, 02:20
... TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan probe 18S TGGACCGGCGCAAGACGGAC AB Fig. ... kit (Stratagene, La Jolla, CA, USA). Mutagenic primers were: 5Â-CGCTCGAGA TGAAAATTGACATC GCTAGTCATATTCTACC-3Â and its complement for His6Ala; 5Â-GACATCCATAGT GCT ATTCTACCAAAAGAATGGCC-3Â and its ... rev, reverse. Sequence ACMSD cloning: primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe 1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw...
  • 14
  • 601
  • 0
Philosophy in a New Key A Study in the Symbolism of Reason, Rite, and Art

Philosophy in a New Key A Study in the Symbolism of Reason, Rite, and Art

Ngày tải lên : 14/03/2014, 17:25
... says, "certainly have quite elaborate 'ape-ways' into which a newcomer is gradually acculturated, including among other patterns ways of using available instruments for reaching ... for nearly a thousand years of philosophical growth, beginning with the early Church Fathers and culminating in the great Scholastics. But, at last, its generative ideas—sin and salvation, nature and ... world is a back yard, or it may be as wide as an eagle's range and as complicated as a monkey's jungle preserve. That depends on the variety of signals a creature can receive, the variety...
  • 255
  • 564
  • 0
Expect the Unexpected: Building business value in a changing world pptx

Expect the Unexpected: Building business value in a changing world pptx

Ngày tải lên : 15/03/2014, 21:20
... been taking place at several times the natural replacement rate, the amount of available arable land per person has dropped substantially and agricultural productivity has slowed. At the same ... supplies especially in Central Asia, and conversion of coral reefs to algal dominated systems. 16 Business is both heavily involved in causing this damage and likely to be increasingly affected ... freshwater use). 5 Assessing the Erosion Nexus in a business context may generate insights such as: ã Demandandsupplystressesare likely to be concentrated in areas such as China and India that...
  • 180
  • 413
  • 0
Báo cáo khoa học: Insect cytokine, growth-blocking peptide, is a primary regulator of melanin-synthesis enzymes in armyworm larval cuticle pptx

Báo cáo khoa học: Insect cytokine, growth-blocking peptide, is a primary regulator of melanin-synthesis enzymes in armyworm larval cuticle pptx

Ngày tải lên : 16/03/2014, 11:20
... pair (5Â-ATGGAGGCCGGAGATTTCAAAG-3Â, +1 to +22 bp; and 5Â-ACGGGCTTTAAGTATTTCATCAGGC-3Â, +1405 to +1428 bp) and actin primer pair (5Â-TTCGAGCAG GAGATGGCCACC-3Â and 5Â-GAGATCCACATCTGYTG GAAGGT-3Â). ... Mishra JP, Mishra S, Gee K & Kumar A (2005) Differ- ential involvement of calmodulin-dependent protein kinase II-activated AP-1 and c-Jun N-terminal kinase- activated EGR-1 signaling pathway in ... of armyworm larvae. Experimental procedures Animals Pseudaletia separata larvae were reared on an artificial diet at 25 ± 1 °C in a photoperiod of 16:8 light ⁄ dark [10]. Pen- ultimate instar larvae...
  • 10
  • 440
  • 0
Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx

Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx

Ngày tải lên : 23/03/2014, 20:22
... chloroplast genome of the redalga Porphyra purpurea. Plant Cell 5, 465–475. 35. Kaneko, T., Tanaka, A. , Sato, S., Kotani, H., Sazuka, T., Miyajima, N., Sugiura, M. & Tabata, S. (1996) Sequence analysis of ... K., Kimura,T.,Kishida,Y.,Kohora,M.,Matsumoto,M.,Matsuno, A. , Muraki, A. , Nakazaki, N., Shimpo, S., Sugimoto, M., Taka- zawa, M., Yamada, M., Yasuda, M. & Tabata, S. (2001) Complete genomic sequence of the filamentous nitrogen-fixing cyanobacterium ... Plant J. 15, 99–107. 37. Kaneko, T., Nakamura, Y., Wolk, C.P., Kuritz, T., Sasamoto, S., Watanabe, A. , Iriguchi, M., Ishikawa, A. , Kawashima, K., Kimura,T.,Kishida,Y.,Kohora,M.,Matsumoto,M.,Matsuno, A. ,...
  • 12
  • 459
  • 0
Socio-demographic characteristics of patients presenting pulmonary tuberculosis in a primary health centre, Zaria, Nigeria ppt

Socio-demographic characteristics of patients presenting pulmonary tuberculosis in a primary health centre, Zaria, Nigeria ppt

Ngày tải lên : 29/03/2014, 03:20
... immunization, antenatal care, postnatal, family planning and laboratory services. The study subjects include Nigerians aged 8 years and above residing in Zaria, Kaduna State, Nigeria since there ... Nigeria National Demographic Health Survey Report 2003. Nirupa CG, Sudha GT, Santha TC, Ponnuraja CR, Fathima RV, Chandrasekharan VK, Jaggarajamma K, Park K (2005). Textbook of Preventive and ... determine the socio- demographic characteristics of patients presenting with pulmonary TB (PTB) at a primary health care centre in Zaria, Kaduna State of Nigeria. STUDY POPULATION AND METHODOLOGY...
  • 4
  • 322
  • 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

Ngày tải lên : 31/03/2014, 01:20
... utilized two acyltransferase inhibitors. SK&F 98625, originally described as a CoA-independent acyltransferase inhibitor [16], was included as it inhibits both LPCAT and LPAAT in MonoMac 6 cells ... the cell walls of Gram-negative bacteria, is an important microbial molecular pattern that initiates in ammatory and coagulation reactions as part of the host innate immune response to infection. ... U 1A and one for TNF -a. The level of U 1A mRNA was similar in all samples as shown in Fig. 4A. This indicated equal extraction efficiency and that SK&F 98625 was not a general transcription inhibitor....
  • 7
  • 322
  • 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

Ngày tải lên : 31/03/2014, 15:20
... the experimental data was obtained as a function of time t .In these computations, the initial value for each of the rate constants was taken f rom the corresponding slo pe of a biphasic curve (as delineated ... conđguration, the a1 b2anda2b1 contacts undergo the principal changes associated with the cooperative oxygen binding, so that these are named the sliding contacts. At the a1 b1anda2b2 interfaces, ... chain heterogeneity could be maintained even in the low concentrations of hemoglobin corresponding to appreciable dissociation into a1 b1and a2 b2 dimers [5]. When the a and b chains are separated from...
  • 10
  • 648
  • 0