ultrasound detecting peritoneal fluid with a very high sensitivity detecting which organ is damaged plays important role in guiding and monitoring of lesion progression

Báo cáo khoa học: " Geographical Information System (GIS) as a Tool in Surveillance and Monitoring of Animal Diseases" potx

Báo cáo khoa học: " Geographical Information System (GIS) as a Tool in Surveillance and Monitoring of Animal Diseases" potx

Ngày tải lên : 12/08/2014, 15:20
... because this is not yet a standard tool in the available GIS-packages The visualisation of the disease rates on digital maps can be misleading because the eye tends to interpret point patterns as ... the case farm and all farms at risk within a specified area of the outbreak Buffer zones can be drawn around those farms as shown in Fig and with a link to tables of the addresses of the farms at ... string of such co-ordinates A polygon is a closed line The grid-based format of data is captured as information of each quadratic cell in a screen and could be looked at as a photo of the area...
  • 7
  • 341
  • 0
Báo cáo khoa học: "Whole shoot hydraulic resistance in Quercus species measured with a new high-pressure flowmeter" pps

Báo cáo khoa học: "Whole shoot hydraulic resistance in Quercus species measured with a new high-pressure flowmeter" pps

Ngày tải lên : 08/08/2014, 23:22
... al, 1993) and for Acer saccharum and Populus deltoides (Tyree and Alexander, unpublished data) The leaf-blade resistance includes vascular and nonvascular pathways from the base of the leaves to ... stomata of some leaves and F became stable Shoot resistance was computed from: where P was the applied water pressure, and A was the total leaf area of the shoots measured with a delta-T leaf area ... mesophyll airspaces, but we are of the opinion that the main resistance to water flow is probably in the nonvascular part of the path (Tyree and Cheung, 1977) Leaf-blade resistances are relevant to a...
  • 7
  • 313
  • 0
A very high speed bandpass continous time sigma delta modulator for RF receiver front end a d conversion

A very high speed bandpass continous time sigma delta modulator for RF receiver front end a d conversion

Ngày tải lên : 26/09/2015, 10:51
... baseband ADC regarding dynamic range, bandwidth and linearity are relaxed due to the filters which are preceding it Sampling the baseband signal also leads to lower sampling rate, resulting in ... translation, channel filtering, and quadrature demodulation are done in DSP This ADC should have a high dynamic range, high linearity and large bandwidth at RF frequencies Since the sampling rate ... just altering the software in it A few implementations of very high frequency bandpass Sigma Delta modulators in bipolar RF transistors of SiGe HBT [7], AlGaAs/GaAs HBT [20] and InP HBT [21] have...
  • 112
  • 359
  • 0
Tài liệu Experiences in Design and Implementation of a High Performance Transport Protocol doc

Tài liệu Experiences in Design and Implementation of a High Performance Transport Protocol doc

Ngày tải lên : 15/01/2014, 15:59
... Efficiency and Fairness Characteristics • Takes 7.5 seconds to reach 90% of the link capacity, independent of BDP • Satisfies max-min fairness if all the flows have the same end-to-end link capacity ... (Additive Increase Multiplicative Decrease) • Fair: max-min fairness • Stable: globally asynchronously stable • But, inefficient and not scalable – In grid networks (with high bandwidth-delay product) ... shortcomings of TCP • We explained the design rationale and implementations details in this paper Future Work • Bandwidth Estimation • CPU utilization – Self-clocking – Code optimization • Theoretical...
  • 32
  • 580
  • 0
Báo cáo khoa học: NtKTI1, a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response pot

Báo cáo khoa học: NtKTI1, a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response pot

Ngày tải lên : 23/03/2014, 03:20
... 5¢-GATTCTTAGCAGGTTCATCGCCATCT-3¢ 5¢-TGCACACACTTGGACAGAACAC-3¢ 5¢-GCGAAAACCTAGCTTGGGGAAG-3¢ 5¢-TATATAACGTGAAATGGACGC-3¢ 5¢-GAAGCTCTTCAGGAGGCACTTCCT-3¢ 5¢-CAATGGTGGGTACGCAGAGAGGAT-3¢ 5¢-GAAGCTTACGTTCCGATGCAAAGTC-3¢ ... antimicrobial assay and in planta studies demonstrated that NtKTI1 is an antifungal protein that increases the resistance of tobacco to fungal attack Results Isolation and characterization of a cDNA encoding ... 5¢-GAAGCTTACGTTCCGATGCAAAGTC-3¢ 5¢-AGAAAGTACAAATATCCATTC-3¢ 5¢-GAATTTAGTGATGGGCATGCTCCTG-3¢ 5¢-AGTAATCTTATCAGATTCACCAC-3¢ RT-PCR The constitutively expressed gene in tobacco, EF 1a, was also subjected to RT-PCR at...
  • 13
  • 501
  • 0
Báo cáo khoa học nông nghiệp " Selection and development sweet potato varieties with high root quality for food processing in Northern and Central of Vietnam " MS4 pot

Báo cáo khoa học nông nghiệp " Selection and development sweet potato varieties with high root quality for food processing in Northern and Central of Vietnam " MS4 pot

Ngày tải lên : 21/06/2014, 04:20
... growth in three provinces of Bac Giang, Thanh Hoa and Quang Tri in 2008-2009 - Evaluate and and select new potato varieties in Bac Giang based on quality and yield - Evaluate and select new potato ... l.copeland@usyd.edu.au In Australia: Administrative contact Annette Vervoort Name: Adm Assistant Position: Organisation Faculty of Agriculture, Food and Natural Resources, University of Sydney ... sweet potato varieties in Project CARD 008/07VIE No Criteria Varieties KL5 No KB1 10 11 HT2 TM1 Vine shape Half standing Half standing Half standing Half standing Half standing Root skin colour...
  • 16
  • 391
  • 0
Báo cáo nghiên cứu nông nghiệp " Selection and development sweet potato varieties with high root quality for food processing in Northern and Central of Vietnam " potx

Báo cáo nghiên cứu nông nghiệp " Selection and development sweet potato varieties with high root quality for food processing in Northern and Central of Vietnam " potx

Ngày tải lên : 22/06/2014, 13:20
... example flour and starch as a raw material for industry in the manufacture of foods, confectionery, pharmaceuticals, paper and textiles The demand of starch for industry in Vietnam annually is ... - Quang Tri province (Vinh Thai-Vinh Linh, Gio Hai- Gio Linh, Hai Quy- Hai Lang) 2.3 Research content - Evaluate and select new potato varieties in Bac Giang and Thanh Hoa based on quality and ... of the sweet potato varieties at all of before planting locations in Bac Giang and Thanh Hoa, 2008 - Half of the remaining Urea and Kali (Table 1) The highest dry matter content in fertilizers...
  • 9
  • 455
  • 0
Báo cáo lâm nghiệp: "Variations in growth and virulence of Leptographium wingfieldii Morelet, a fungus associated with the bark beetle Tomicus piniperda L" pot

Báo cáo lâm nghiệp: "Variations in growth and virulence of Leptographium wingfieldii Morelet, a fungus associated with the bark beetle Tomicus piniperda L" pot

Ngày tải lên : 08/08/2014, 01:22
... inoculations was always highly and positively correlated with the percentage of blue stained sapwood and negatively with the percentage of healthy sapwood, the two latter parameters being also highly and ... species and originating from the same forest This interesting result could be of great practical use for screening and comparing fungal virulence of various fungal isolates, at least in this particular ... dish containing 20 ml of malt agar (VWR International) medium (3% malt, 1.6% agar) At each temperature, replicates were used for each isolate, and the growth was recorded each day during days by...
  • 9
  • 308
  • 0
Báo cáo y học: " High sensitivity C-reactive protein is associated with lower tibial cartilage volume but not lower patella cartilage volume in healthy women at mid-life" pdf

Báo cáo y học: " High sensitivity C-reactive protein is associated with lower tibial cartilage volume but not lower patella cartilage volume in healthy women at mid-life" pdf

Ngày tải lên : 09/08/2014, 10:23
... analysis and interpretation of the data AW performed data analysis FC and SDavis were responsible for study design and data analysis and interpretation and SDavison reviewed the final draft All ... (alpha error 0.05, two-sided significance), thus explaining up to 6% of the variance of cartilage volume Statistical analysis The analytical approach used in this analysis was linear regression with ... values for factors potentially contributing to total tibial cartilage and patella volumes are shown in Tables and For total tibial cartilage, total bone area explained 14% of the variation in...
  • 7
  • 359
  • 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Ngày tải lên : 21/02/2014, 01:21
... D-galactose and 0.3% L-arabinose and is predominantly linear Potato arabinogalactan consists of 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan consists of 57% D-galactose and ... 4.5 No activity of GALA could be detected against any of the transgalactooligosaccharides listed in Materials and methods Purification and characterization of GALA Hydrolysis of arabinogalactans ... activity of GALA with different arabinogalactans was measured in duplicate by HPAEC and MALDI-TOF MS after incubation of mgÆmL)1 of potato, onion and soy arabinogalactan with 1.33 lgÆmL)1 GALA at 30...
  • 9
  • 669
  • 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Ngày tải lên : 07/03/2014, 16:20
... (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) ... obtained from pJH2-SSTR2 by homologous recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and ... yeast strain induced at 15 °C, and from yeast expressing SSTR2 as a control activity By taking advantage of structural and functional similarities between yeast and mammalian GPCR signaling pathways,...
  • 14
  • 473
  • 0
Báo cáo khoa học: A mitochondrial cytochrome b mutation causing severe respiratory chain enzyme deficiency in humans and yeast doc

Báo cáo khoa học: A mitochondrial cytochrome b mutation causing severe respiratory chain enzyme deficiency in humans and yeast doc

Ngày tải lên : 16/03/2014, 22:20
... evidence of basal ganglia calcification and extensive high signal changes in the cerebral white matter, consistent with mitochondrial leukoencephalopathy Histochemical and biochemical analysis Histological ... structural analysis Lys319 is located at the C-terminal region of a b-turn linking helices F2 and G (Fig 5) and probably acts as a backbone H-bond donor to Asn316 Mutation of Lys319 to a proline ... gene mutation in a patient with muscle weakness and muscle pain and with biochemical evidence of a severe, combined deficiency of complexes I and III of the mitochondrial respiratory chain A pathogenic...
  • 10
  • 317
  • 0
Factors affecting delays in diagnosis and treatment of pulmonary tuberculosis in a tertiary care hospital in Istanbul, Turkey pptx

Factors affecting delays in diagnosis and treatment of pulmonary tuberculosis in a tertiary care hospital in Istanbul, Turkey pptx

Ngày tải lên : 22/03/2014, 18:20
... 117: 251-53 24 Yamasaki-Nakagawa M, Ozasa K, Yamada N et al: Gender difference in delays to diagnosis and health care seeking behaviour in a rural area of Nepal Int J Tuberc Lung Dis, 2001; 5: 24-31 ... Güneylioglu D et al – Delays in pulmonary tuberculosis diagnosis and treatment 12 Wandwalo ER, Morkve O: Delay in tuberculosis case-finding and treatment in Mwanza, Tanzania Int J Tuberc Lung Dis 2000; ... sources of infection, delays in the diagnosis and treatment of these patients increase the risk of disease transmission in the community These delays are also associated with a prolonged period of infectivity...
  • 6
  • 466
  • 0
Báo cáo khoa học: A peptide derived from cyclin-dependent kinase activator (p35) specifically inhibits Cdk5 activity and phosphorylation of tau protein in transfected cells pdf

Báo cáo khoa học: A peptide derived from cyclin-dependent kinase activator (p35) specifically inhibits Cdk5 activity and phosphorylation of tau protein in transfected cells pdf

Ngày tải lên : 23/03/2014, 21:21
... labelled arrows (B) A combination of N-terminal and C-terminal truncations of p35 produces a nonactivating fragment (154–279, CIP) that inhibits Cdk5 activity and binds with high a nity (C) Inhibition ... with polyclonal antip35 (C-19) and anti-AT8 Ig (a, c, and e) and with polyclonal antip35 (N-20) and anti-AT8 Ig (b, d, and f) a and b expressed transfected p25 and p35, respectively; c and d expresses ... CIP (a and b), Cdk5 (c), and p25 (d) Cells were fixed and double-stained with anti-Xpress-FITC and polyclonal anti-Cdk5 (C-8) antibodies (a, c, and e) and with anti-Xpress-FITC and polyclonal antip35...
  • 8
  • 329
  • 0
Báo cáo sinh học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition potx

Báo cáo sinh học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition potx

Ngày tải lên : 18/06/2014, 18:20
... 5'ATGGCGGATAAAAAAAATTTAGCC and A1 2L-reverse: 5'TTA ATACATTCCCATATCCAGACAAAATTCG In order to construct A1 2L with abrogated cleavage at an N-terminal AG /A site (AG /A) , the AG /A sites were altered into ... and TOPO vector, two different sets of primers were designed; pA12Lforward: 5'-CACTCCATGGATGGCGG ATAAAAAAAATTTAGCC and pA12L-reverse: 5'-CAGGATCCTTAATACATTCCCATATCCA GACAAC; p233-forward: 5'ATGGCGGATAAAAAAAATTTAGCC ... mutagenesis kit (Stratagene) with a specific primer, which has the changed sequences at the residues 55–57 (underlined), 5'CTTAATTCTCAAACAGATGTGACTATCGACATCTGTGATACAAAATCAAAGAGTTCA-3' The AG/A...
  • 6
  • 397
  • 0
Báo cáo hóa học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition" pdf

Báo cáo hóa học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition" pdf

Ngày tải lên : 20/06/2014, 01:20
... 5'ATGGCGGATAAAAAAAATTTAGCC and A1 2L-reverse: 5'TTA ATACATTCCCATATCCAGACAAAATTCG In order to construct A1 2L with abrogated cleavage at an N-terminal AG /A site (AG /A) , the AG /A sites were altered into ... and TOPO vector, two different sets of primers were designed; pA12Lforward: 5'-CACTCCATGGATGGCGG ATAAAAAAAATTTAGCC and pA12L-reverse: 5'-CAGGATCCTTAATACATTCCCATATCCA GACAAC; p233-forward: 5'ATGGCGGATAAAAAAAATTTAGCC ... mutagenesis kit (Stratagene) with a specific primer, which has the changed sequences at the residues 55–57 (underlined), 5'CTTAATTCTCAAACAGATGTGACTATCGACATCTGTGATACAAAATCAAAGAGTTCA-3' The AG/A...
  • 6
  • 401
  • 0
PHYTOCHEMICALS – A GLOBAL PERSPECTIVE OF THEIR ROLE IN NUTRITION AND HEALTH potx

PHYTOCHEMICALS – A GLOBAL PERSPECTIVE OF THEIR ROLE IN NUTRITION AND HEALTH potx

Ngày tải lên : 28/06/2014, 11:20
... Oliveira, Pedro G.V Aquino, Magna S Alexandre-Moreira and Antụnio E.G SantAna Chapter 17 Phytochemistry, Pharmacology and Agronomy of Medicinal Plants: Amburana cearensis, an Interdisciplinary Study 353 ... Cutler Chapter 14 Alkaloids and Anthraquinones from Malaysian Flora 287 Nor Hadiani Ismail, Asmah Alias and Che Puteh Osman Chapter 15 Phytochemistry of some Brazilian Plants with Aphrodisiac Activity ... Present in Vernonanthura Patens with Antifungal Bioactivity and Potential as Antineoplastic 503 Patricia Isabel Manzano Santana, Mario Silva Osorio, Olov Sterner and Esther Lilia Peralta Garc a Chapter...
  • 548
  • 1.1K
  • 0
Báo cáo lâm nghiệp: " Fungi associated with Tomicus piniperda in Poland and assessment of their virulence using Scots pine seedlings" doc

Báo cáo lâm nghiệp: " Fungi associated with Tomicus piniperda in Poland and assessment of their virulence using Scots pine seedlings" doc

Ngày tải lên : 07/08/2014, 16:20
... associated with T piniperda were investigated In addition, the pathogenicity of several blue-stain fungi associated with T piniperda was investigated by inoculating Scots pine seedlings MATERIALS AND ... associated with T piniperda than L wingfieldii and presumably plays a more important role in overcoming the resistance of Scots pine attacked by beetles in Poland Acknowledgements: This work was partly ... removing a small sapwood samples near the points of inoculation and incubating them on 2% MEA at 22 ◦ C RESULTS 3.1 Fungal isolation In this study, 837 fungal isolates were isolated from gallery...
  • 8
  • 432
  • 0
Báo cáo y học: "α Does protein kinase R mediate TNF-α- and ceramide-induced increases in expression and activation of matrix metalloproteinases in articular cartilage by a novel mechanism" pps

Báo cáo y học: "α Does protein kinase R mediate TNF-α- and ceramide-induced increases in expression and activation of matrix metalloproteinases in articular cartilage by a novel mechanism" pps

Ngày tải lên : 09/08/2014, 01:23
... The amount of sGAG remaining within the cartilage explant after 24 hours of treatment with TNF-α and C2-ceramide in the presence and absence of 2-AP was determined by papain digestion and DMMB assay ... penicillin and 10 µg/ml streptomycin In vitro cartilage samples Cartilage was taken from the metacarpophalangeal joint of 7-day-old bovine calves within 12 hours of slaughter using a scalpel and ... mechanisms that may be important in arthritic disease Materials and methods Materials All chemicals were obtained from Sigma (Poole, UK) unless otherwise stated and were of analytical grade Recombinant...
  • 10
  • 379
  • 0
Báo cáo y học: "Ultrasonography, magnetic resonance imaging, radiography, and clinical assessment of inflammatory and destructive changes in fingers and toes of patients with psoriatic arthritis" pot

Báo cáo y học: "Ultrasonography, magnetic resonance imaging, radiography, and clinical assessment of inflammatory and destructive changes in fingers and toes of patients with psoriatic arthritis" pot

Ngày tải lên : 09/08/2014, 10:21
... interphalangeal; MCP, metacarpophalangeal; MTP, metatarsophalangeal; NA, not applicable; PIP, proximal interphalangeal; PsA, psoriasis-associated arthritis; RA, rheumatoid arthritis Page of 13 (page ... joint of a patientresonance imaging (MRI) and ultrasonography (US) in longitudinal dorsal (d) and palmar (e) views of the 3rd distal interphalangeal joint of a patient with psoriasis-associated ... dinal dorsal (d) and palmar (e) views T1-weighted coronal (b) and axial (c) magnetic with psoriasis-associated arthritis Projection radiography (x-ray) (a) and of the 3rd distal interphalangeal...
  • 13
  • 449
  • 0