... Enzyme glutamatedehydrogenase liên kết với α-ketoglutarate, làm cho hydro chuyển vào vị trí riêng biệt, phản ứng tạo nên Lglutamate Một ion amoni khác kết hợp với glutamate tác dụng enzyme glutamine ... tác dụng enzyme aspartat – amoniac – liza tạo nên acid aspartic: aspartatamoniacliase + NH3 Phản ứng phản ứng thuận nghịch Acid aspartic tổng hợp cách chuyển hóa acid oxalacetic acid glutamic ... NADP+ reductase O C C H CH2 CH3 CH2 CHO N-acetyl-glutamic-gamasemialdehyde P N-acetyl-gama-glutamine phosphate N-acetyl glutamate HN H CH3 CH2 COOH glutamate C COOH glutamate alphaketoglutarate HN...
... globin α globi n Hình 6: Phân tử Hb hồn chỉnh ~ 10 ~ Hemoglobin Myoglobin GVHD: TS Trần Bích Lam Hình 7: Các chuỗi alpha & beta Hình 7: Các chuỗi alpha & beta TỔNG HỢP GLOBIN: Hình 8: Tổng hợp ... phản ứng phân áp CO2 định HbCO2 có màu đỏ thẫm, đặc trưng cho máu tĩnh mạch Chỉ khoảng CO2 vận chuyển hình thức SƠ ĐỒ VẬN CHUYỂN CO2 ∗ Ở mơ : PCO2 = 46mmHg : phản ứng theo chiều thuận Ở phổi: ... khả nín thở lặn lâu nước có nhiều myoglobin người bình thường Myoglobin có chức vụ gián tiếp trường hợp thương tổn bắp thịt Myoglobin khỏi mơ thịt bi thương tổn lọc vào nước tiểu làm nước tiểu...
... Kjendahl vào bình định mức 100ml ,thêm nước cất ngấn chia,lắc Dụng cụ cất trước sử dụng phải rửa : lấy vào bình tam giác 10ml H2SO4 0,1N ,thêm vài giọt thị phenolphthalein lắp vào máy cất mô hình ... albumin,sau cho nước cất vào kết tủa tan nước cất − Do Albumin trở trạng thái dung dịch keo ban đầu, kết tủa tan hoàn toàn (hiện tượng kết tủa thuận nghịch) 2)Cho vào ống nghiệm 3ml lòng trắng trứng , ... Ống nghiệm Sau cho vào ống 1ml nước bọt 1ml dd tinh bột, lắc Sau vài phút, thêm vào ống vài giọt thuốc thử Lugol, lắc Ống 1ml nước cất Màu vàng đậm Ống 1ml dd NaCl 1% Màu vàng nhạt Ống 1ml dd...
... required to prevent mitotic catastrophe after DNA damage Nature 1999, 401(6753):616-620 Osada H, Tatematsu Y, Yatabe Y, Nakagawa T, Konishi H, Harano T, Tezel E, Takada M, Takahashi T: Frequent and ... silver stained gel image of the master gel image 2-D pattern of the silver stained gel image of the master gel image 2-D pattern of the silver stained gel image of a master gel image containing ... 77 67 #02-05p 129 76 77 67 #02-02b Figure Detail of the two-dimensional patterns of patient A Detail of the two-dimensional patterns of patient A Detail of the two-dimensional patterns of patient...
... inter-platform qualitative and quantitative concordance [58,61] Quantitative analyses of gene expression comparing array data with other quantitative gene expression technologies such as quantitative realtime ... melanoma metastases to high dose IL-2 therapy [9] and a poor prognostic marker of survival in colorectal cancer [141], it is possible that this observation may provide an important target for ... Petricoin EF, Wulfkuhle JD: Pathway Biomarker Profiling of Localized and Metastatic Human Prostate Cancer Reveal Metastatic and Prognostic Signatures (dagger) J Proteome Res 2009, 8:3044-3054...
... fatigue syndrome Data are presented as mean ± standard deviation Candidate genes In the present study, we only focused on the 42 SNPs as described in Table 2[18] As shown in Table 2[18], there ... disease status, "CFS" or "control") of data instances in the testing set, given only the assigned features (that is, the SNP information of the subjects) Given a training set of instance-label ... repeated nine more times by leaving out a different tenth of data as testing data and different nine-tenths of the data as training data Finally, the average estimate over all runs was reported...
... GTTTTGTTTTTGTTTTTTTTGTATAGGTTTTATAGTGCGTTTGGTCGGCGTTTTATA GTTGTAGTTTGGGCGGTTTCGTTAGTTGTTTTTCGTTTTTTTTAGGTTATTTTTGTCG GGCGTTTCGCGAAGATGTAGTTTAAGTCGATGGAGATTAATTTCGAGGTGAGCGTT AGGTGTATCGTTATTCGGAGAGCGCGAGGTCGAGGGAGGGGGAGTCGAGTCGTT ... reaction buffer containing 0.2 mM dNTP mix, 1.5 mM MgCl2, U Taq polymerase and 10 pmol of the primers 5'-GAG TTT TAG AGT AAT TGG GAT GGT GAA-A-3' and 5'-CCA CTC ACT TTA TTC AAC ATC TAA AAA ACA-3' ... experimental design, manuscript preparation, data interpretation DH: experiments, methylation studies ES: experiments, mRNA and protein expression JB: primer design, data analyses and interpretation...
... Annotation encompasses documentation of the biospecimen's composition, as well as linkage to health data associated with the patient and their condition, treatment and outcome Processed and annotated ... Units which are embedded in the hospital pathology departments and facilitates research orientated biospecimen processing by trained personnel using SOPs; 2) data management infrastructures which ... periodic download of the Consent Catalogue as an encrypted file to each BCU computer workstation Using an unsupervised query tool, the BCU inventory database will establish linkage between biospecimens...
... labeling Transplantation of nano-labeled cells Cells to be transplanted were detached on the following day by gentle washing with CDB and maintained in cell media until transplantation NOD/SCID ... Oberkochen, Germany) using the Metamorph software (Molecular Devices, Sunnyvale, CA) Image stacks of thin serial sections were obtained from selected sections by Z-stage scanning Blinded 3D deconvolution ... below Total cells were detached on the following day by gentle washing with Cell Dissociation Buffer (CDB, Invitrogen, Carlsbad, CA) and purified according to their levels of ALDH activity by staining...
... vascular resistance in a model of neonatal pulmonary hypertension Am J Respir Crit Care Med 2002, 165:1098-1102 Banas A, Teratani T, Yamamoto Y, Tokuhara M, Takeshita F, Osaki M, Kawamata M, Kato ... cell implantation Lancet 2003, 361:47-49 Kucia M, Reca R, Miekus K, Wanzeck J, Wojakowski W, JanowskaWieczorek A, Ratajczak J, Ratajczak MZ: Trafficking of normal stem cells and metastasis of cancer ... AJ, Konstam MA, Riegger G, Klinger GH, Neaton J, et al: Effect of losartan compared with captopril on mortality in patients with symptomatic heart failure: randomised trial–the Losartan Heart...
... mechanisms in prostate cancer Cancer Immunol Immunother 2007, 56:81-87 20 Takeuchi H, Kitajima M, Kitagawa Y: Sentinel lymph node as a target of molecular diagnosis of lymphatic micrometastasis and local ... AR-T877A mutation that is present in this cancer cell variant [36] It is likely that RU486 may also affect other prostate cancer cell types as well, as double AR mutant metastatic prostate cancer ... therapy for prostate cancer: suppression of orthotopic tumor growth and pre-established lung metastases in an orthotopic model Gene Ther 1999, 6:338-349 Poutahidis T, Rao VP, Olipitz W, Taylor CL,...
... status However, fractal dimension was not associated with either estrogenreceptor status or HER-2/neu status Page of 10 the size of the tumour, estrogen-receptor status, or HER-2/neu status (Table ... were Stage I, 99 (26.4%) were Stage II, and 51 (13.6%) were Stage III All patients selected had received adjuvant tamoxifen treatment between 1988 and 2006 Cases were identified with Alberta Cancer ... between the microscope and digital camera) The images were taken at the camera’s native resolution of 1300 × 1030 pixels, and saved in tagged image file format (tif) Fractal Analysis to Assess Morphologic...
... < 0.01 a Ratio of Z statistics for UK weights & US weights b Ratio of Z statistics for Japan weights & UK weights c Ratio of Z statistics for Japan weights & US weights Table 9: Impact of differences ... study, analyzing the data, and writing the article RC contributed to analyzing the data and the interpretation of the results RS contributed to analyzing and collecting the data All authors have ... protocol, where each respondent was presented with 17 health states, instead of 42 health states The plain main effects model was preferred [11] Data analysis The EQ-5D index scores were calculated using...
... of a long-standing illness Strict tests of unidimensionality are undertaken at every stage of analysis [29] A Principal Component Analysis (PCA) of the residuals is undertaken, the standardised ... the observed data match that expected by the model, using a number of fit statistics In this paper, three overall fit statistics are considered Two are item-person interaction statistics transformed ... qualitative as well as quantitative methods and performed well against classic criteria for scale development [9] WEMWBS showed good content validity, moderately high correlations with other mental...
... neurorehabilitation: a computational motor learning perspective Journal of NeuroEngineering and Rehabilitation 2009, 6:5 24 Riener R, Fuhr T: Patient-driven control of FES-supported standing up: ... and kinematic variability are considered as important promotors of motor learning and rehabilitation [18-23] fMRI studies comparing training tasks with active and passive movements have shown ... important feature to adapt the controller to the individual capabilities of patients, particularly of patients transitioning from a non-ambulatory to an ambulatory state during their rehabilitation...
... animal (n = 6) containing the lesion epicenter and slides containing no signs of damaged spinal cord tissue from above and below the lesion were taken for luxol fast blue (Sigma) staining The lesion ... behavioral signs of the injury This strengthens the interpretation of our data Data analysis To evaluate the latencies, we recorded the time from the start of the stimulus artifact to the onset of the ... was taken from SCI animal B: a representative experiment shows firing rate (spikes/s) during an entire experiment Arrows show the start and end of dCMS application C: quantification of spontaneous...
... doi:10.1023/A:1009752403260 30 MM Mesulam, Spatial attention and neglect: parietal, frontal and cingulate contributions to the mental representation and attentional targeting of salient extrapersonal events Phil Trans ... a short target latency of 500 ms In the remaining trials, the target latency was randomized between 500 ms and 2000 ms in order to ensure that attention is sustained continuously until target ... cases, the target appeared at a different random location The target symbol was randomly chosen, with equal chances for ‘+’ and ‘×’ Target latency (i.e., the time between cue onset and target onset)...
... Experimental set-up and instrumentation Participants were comfortably seated in a position similar to the one during the plantarflexion task of the assessment of coactivation in an adjustable reclining ... sitting position, during two tasks: maximal isometric voluntary contractions in knee extension and in plantarflexion The early facilitation and later inhibition of soleus voluntary EMG evoked by femoral ... one trial of the knee extension task and of the plantarflexion task, in a control participant and a stroke participant (#5 in Table 1) For the knee extension task, the EMG activity of Sol (expressed...
... were acquired by a data acquisition system (MP150, Biopac Systems, Goleta, CA) with a sampling rate of kHz and a resolution of 16 bits Both the data acquisition and experimental protocols were ... dimensional data matrix, where C is the number of retained EEG channels (C ranged between 44 and 46 across all subjects) To facilitate subsequent classification, the dimension of input data was reduced ... spatio-spectral features: f = TA C (d) (1) where d Î ℝ25×C is single-trial EEG data, FC : ℝ25×C ® ℝ is a piecewise linear mapping from the data space into an m-dimensional CPCA-subspace, and TA : ℝm ® ℝ is...