0

treat a bite or sting from an unidentified arthropod

báo cáo khoa học:

báo cáo khoa học:" Lack of association between celiac disease and dental enamel hypoplasia in a case-control study from an Italian central region" pdf

Báo cáo khoa học

... Sangianantoni A, D'Angio F, Santarelli A, Lo Muzio L: Oral aphthous ulcers and dental enamel defects in children with coeliac disease Acta Paediatr 2006, 95(2):203-207 Majorana A, Sapelli PL, Malagoli ... celiac patients, enamel defects have been correlated to an altered phosphate-calcium metabolism and /or formation of antibodies against the matrix of enamel organ The antigen correlated to class ... N, Malhotra V: Adult celiac disease in northern India Indian J Gastroenterol 2003, 22(4):124-126 Lahteenoja H, Toivanen A, Viander M, Maki M, Irjala K, Raiha I, Syrjanen S: Oral mucosal changes...
  • 6
  • 305
  • 0
On the conformation of DNA confined in a nanochannel or absorbed at an interface

On the conformation of DNA confined in a nanochannel or absorbed at an interface

Cao đẳng - Đại học

... Jeroen van kan for providing stamps, without which nothing could be done and Ms Zhang Fang, for helping me with the nano-fabrication work at the early stage I also thank Mr Teo and Mr Michael of ... neutralizations In addition, the attraction can be enhanced when the mica has been pretreated by transition metal cations (Ni2+, Zn2+) Mica pretreatment simultaneously enhances the DNA attraction ... as DNA Different architectures have been designed, including entropic trap arrays, micro and nano-pillar arrays, nano-pores and nanochannels [1-4] The nano-fluidic devices are complementary to...
  • 153
  • 465
  • 0
Is it a preposition is it a conjunction or is it an adverb

Is it a preposition is it a conjunction or is it an adverb

Ngữ pháp tiếng Anh

... literally 'join together' and are of two types: co-ordinating and subordinating There are seven co-ordinating conjunctions, easily remembered with the mnemonic 'FANBOYS' - for, and, nor, but, or, ... Twitter correspondent at Sky News Board and the expected answers are:  How are you getting on at work  An opportunity has come up for a Twitter correspondent at Sky News Board Now correct me ... numerous subordinating conjunctions - before, after, since, until, becauseetc These are the start words of subordinate clauses, which can come before or after the main clause Furthermore, there are often...
  • 6
  • 231
  • 0
Báo cáo y học:

Báo cáo y học: "Do we need a critical care ultrasound certification program? Implications from an Australian medical-legal perspective"

Y học thưởng thức

... the Tort Law Reform and enactments of the Civil Liability Acts (or its equivalents) in most Australian states between 2002 and 2003, the standard of care is taken to be a standard that conforms ... reasonable skill and care - a standard reasonably expected of a practitioner with an equivalent level of training and experience [9] A practitioner is expected to have the relevant qualifications and ... specialists, or doctors who hold themselves out as having special skills, may be required to meet the standard of a doctor with those special skills or a higher standard than the ordinary Huang and McLean...
  • 6
  • 714
  • 0
Tài liệu Pass a Dataset Back from an XML Web Service docx

Tài liệu Pass a Dataset Back from an XML Web Service docx

Cơ sở dữ liệu

... you created the Login windows Form Create a new Windows Form and place the controls shown in Table 13.2 in the order displayed in Figure 13.14 Table 13.2 Label, TextBox, DataGrid, and Command Button ... columns from a data table If the goal is to include all the columns in the table and accept the Password column, then when other columns are added, you will not have to touch the code because the ... the button labeled How-To 13.4 The form for How-To 13.4 then opens If you type FSBarker for the User and Test for the Password, you can see the user's information listed in the DataGrid object...
  • 4
  • 283
  • 0
Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf

Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf

Báo cáo khoa học

... were from TaKaRa Bio (Kyoto, Japan) Crotalus atrox phosphodiesterase I was purchased from Sigma (St Louis, MO, USA) The other chemical reagents were purchased from Wako (Osaka, Japan) or Sigma In ... 12–19 19 Ohtani N, Yanagawa H, Tomita M & Itaya M (2004) Identification of the first archaeal type RNase H gene from Halobacterium sp NRC-1: archaeal RNase HI can cleave an RNA-DNA junction Biochem ... here is a bifunctional enzyme consisting of an RNase H domain and an APase domain, and it is a novel style in the Type RNase H family Experimental procedures Cells, plasmids, and materials The...
  • 10
  • 561
  • 1
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Báo cáo khoa học

... Tanaka H, Yamamoto T, Shibuya Y, Nishino N, Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aeruginosa elastase II Kinetic analysis and identification ... Pa3 Pa4 Pa5 Pa6 Pa7 Pa8 Pa9 Pa10 Pa11 Pa12 Ac-EVYLVE-NH2 Ac-EVYLLE-NH2 Ac-EVYLAE-NH2 Ac-EVYAVE-NH2 Ac-EVYALE-NH2 Ac-EVYAAE-NH2 Ac-ELYLVE-NH2 Ac-ELYAVE-NH2 Ac-ELYLLE-NH2 Ac-ELYLAE-NH2 Ac-ELYALE-NH2 ... internal standard, because it was not hydrolysed by PrtA Peak areas were normalized with the internal standard, and the degree of cleavage was calculated from the reduction in the normalized area...
  • 11
  • 424
  • 0
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc

Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc

Quản trị kinh doanh

... Project Coordinator Vishal Bodwani Proofreader Aaron Nash Kishore Shenoi Pankaj Ghanshani Indexer Tejal Daruwale Acquisition Editors Amey Kanse Kartikey Pandey Lead Technical Editor Kartikey Pandey ... compensation The mai-baap manager The Indian manager has a unique role to play, that of mai-baap (mother-father, that is, parents) Many team members also expect the manager to play almost a parental ... implemented and work with other departments or teams to participate or facilitate A manager acts as an entrepreneur to design and create a change in the organization For example: • Create innovations...
  • 328
  • 4,476
  • 0
Báo cáo Y học: A neuropeptide Y receptor Y1-subfamily gene from an agnathan, the European river lamprey doc

Báo cáo Y học: A neuropeptide Y receptor Y1-subfamily gene from an agnathan, the European river lamprey doc

Báo cáo khoa học

... using a linear gradient Absorbance was measured at 214 and 280 nm and the major peak in the chromatogram was collected by hand The identity of the peptides was confirmed by automated Edman degradation ... extracellular loop and loop 2, and a cysteine in the C-terminal tail where palmitoylation could serve as an anchor to the membrane and form a pseudo fourth loop (Fig 1) Apart from these general ... implications of the cDNA sequence of the single lactate dehydrogenase of a lamprey Proc Natl Acad Sci USA 89, 1799–1803 Sharman, A. C., Hay-Schmidt, A & Holland, P.W (1997) Cloning and analysis of an...
  • 9
  • 290
  • 0
báo cáo sinh học:

báo cáo sinh học:" How labour intensive is a doctor-based delivery model for antiretroviral treatment (ART)? Evidence from an observational study in Siem Reap, Cambodia" potx

Điện - Điện tử

... explored Particularly, the extrapolation of findings on use of doctor-time from Cambodia to sub-Saharan Africa may not be warranted Indeed, there are important differences in medical practise and ... study, participated in data collection and data analysis, and reviewed successive drafts of the manuscript Kheang Soy Ty participated in the data collection, provided the background information and ... different layers of learning and adaptation can potentially have a multiplication effect, and may take more time for materialising However, it is our contention that, more conscious efforts will have...
  • 9
  • 451
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " The complete genome sequence of a Crimean-Congo Hemorrhagic Fever virus isolated from an endemic region in Kosovo" pot

Hóa học - Dầu khí

... of Kosova Hoti B Scheme of the L protein of Kosova Hoti strain DD performed RNA extraction, qualitative and quantitative RT-PCR, analyzed the data and prepared the draft manuscript MK and STN ... group V was similar in the S and L segment tree (Fig 1, panels A and C), where it formed a separate lineage ancestral to the three Russian isolates and CCHFV strain 200310849 from Turkey was the ... and L segment sequences and revised the draft manuscript AS sequenced the complete S segment IHB performed the protein analysis MP, ID and SA collected the samples and clinical data TAZ isolated...
  • 6
  • 320
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

Hóa học - Dầu khí

... http://www.virologyj.com/content/5/1/13 AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGGCAAAGAGTTTCTCAGGGAAACT 64 TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG ... 1722 243 -GTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAGAAAGGTGGCGGCT || |||||| || | |||||| |||||||||||||| || |||||||| || ||||||| 1723 CGT-GTACGTAGGAAACAACAACGAATACCGCATCAGCCTGGCCAAGAAGGGCGGCGGCT ... TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG ||||||||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| 1544 TGGACCCGTTTCATGGAAGACAGCTTCCCTATCGTGAACGACCAAGAAATTATGGACGTG 63 1543...
  • 11
  • 854
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Highly stable meso-diaminopimelate dehydrogenase from an Ureibacillus thermosphaericus strain A1 isolated from a Japanese compost: purification, characterization and sequencing" doc

Hóa học - Dầu khí

... investigation Acknowledgements We thank to Prof Yutaka Kawarabayashi and Dr Hiroaki Matsukawa for their kind advice This work was supported by a grant for Promotion of Basic Research Activities for ... -plus- DNA polymerase (Toyobo) with primers 5´-CACCATGAGTAAAATTAGAATTGGG-3´ (forward) and 5´-TAAAAGTTCTTTTCTTAAATCTTCTGGAG-3´ (reverse), and then cloned using a ChampionTM pET 101 Directional TOPO ... donor and NADP as the electron acceptor at 50°C N-Terminal amino acid sequence analysis The N-terminal amino acid sequence of the isolated enzyme was analyzed using an automated Edman degradation...
  • 37
  • 309
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A canine distemper virus isolated from an autopsied dog in Hanoi, Vietnam" pot

Báo cáo khoa học

... Activation Molecule (SLAM) J Comp Pathol 133, 77-81 Lan, N.T., Yamaguchi, R., A Kawabata, K.Uchida, S Sugano, and Tateyama, S., 74 (2006) Comparison of molecular analysis and growth properties ... instructions A mixture of μl (150 ng/μl) of random hexanucleotide primers, μl of RNA and μl of DEPC treated water was denatured at 700C for and incubated at room temperature for 10 The cDNA was synthesized ... monoclonal antibody specific for CDV-nucleoprotein and an Envision polymer reagent (DAKO Corporation, USA) as described previously (Kumagai et al., 2004) Virus isolation The homogenized and sonicated...
  • 5
  • 235
  • 1
báo cáo khoa học:

báo cáo khoa học: "Triple malignancy in a single patient including a cervical carcinoma, a basal cell carcinoma of the skin and a neuroendocrine carcinoma from an unknown primary site: A case report and review of the literature" ppt

Báo cáo khoa học

... the analysis of the data HE approved the treatment and analyzed the literature data All authors read and approved the final manuscript Competing interests The authors declare that they have no ... (IL): North American Association of Central Cancer Registries; 2003 Agrawal A, Yau A, Magliocco A, Chu P: Cutaneous metastatic disease in cervical cancer: a case report J Obstet Gynaecol Can 2010, ... Metastasis of carcinoma of the uterine cervix to the nasal dorsum J Craniofac Surg 2009, 20(3):971-973 Baykal C, Baykal Y, Taskiran C, Esinler I, Demirol A, Do an R, Ayhan A: An extraordinary case...
  • 4
  • 310
  • 0
báo cáo khoa học:

báo cáo khoa học: "Volcano-like intermittent bleeding activity for seven years from an arterio-enteric fistula on a kidney graft site after pancreas-kidney transplantation: a case report" pps

Báo cáo khoa học

... Pascher A, Langrehr J, Jonas S, Kahl A, Frei U, Neuhaus P, Pratschke J: Complication rate of pancreas retransplantation after simultaneous pancreas-kidney transplantation compared with pancreas after ... iliac arterio-enteric fistulae Korean J Gastroenterol 2003, 42:77-80, (in Korean) 14 McBeth BD, Stern SA: Lower gastrointestinal hemorrhage from an arterioenteric fistula in a pancreatorenal transplant ... pancreas transplantation is rare and associated with a high mortality rate [2] In the literature, bleeding episodes are described in the setting of the context of pancreatitis of the transplanted organ...
  • 3
  • 213
  • 0
Báo cáo y học:

Báo cáo y học: "Clinicians'''' evaluations of, endorsements of, and intentions to use practice guidelines change over time: a retrospective analysis from an organized guideline program" doc

Báo cáo khoa học

... http://www.implementationscience.com/content/4/1/34 Table 2: Six-year mean, year one mean, and annual change in quality, endorsement and intention scores Domain (Score Range) Mean 6-Year Score (%) Estimated Score ... characteristics and clinician beliefs and attitudes are associated with these trends Methods Context The Cancer Care Ontario Program in Evidence-based Care (PEBC) in Ontario, Canada, a provincial CPG cancer ... examine temporal trends in clinicians' evaluations of, endorsements of, and their intentions to use cancer CPGs developed by an established cancer CPG program; and evaluate how clinician characteristics...
  • 10
  • 228
  • 0
Báo cáo khoa hoc:

Báo cáo khoa hoc:" Giant serous cystadenoma arising from an accessory ovary in a morbidly obese 11-year-old girl: a case report" pptx

Báo cáo khoa học

... cilia, and contain primary follicles, corpora albicans, Graafian follicles, and areas of fibrin deposition [Figure 3] The final histopathological diagnosis was hemorrhagic serous cystadenoma arising ... and analysis of pertinent clinical information Consent Written consent was obtained from the patient's legal guardian (mother) for the publication of this case report and any accompanying images ... doing away with the traditional terms and labeling all abnormally placed ovarian tissue as ectopic, subcategorized as either post-surgical, post-inflammatory, or truly embryological [3] Unfortunately,...
  • 4
  • 180
  • 0
Báo cáo y học:

Báo cáo y học: "Bleeding from ruptured hepatic metastases as a cause of syncope in an octogenarian: a case report" pdf

Báo cáo khoa học

... hemoperitoneum An acute intra-abdominal bleed from the liver metastatic disease was diagnosed Our patient had an esophageal gastro-duodenal endoscopy as he had been taking aspirin and had a past history ... care unit In view of the differential diagnosis of a possible dissection, an urgent chest and abdomen CT scan was performed which showed normal appearances of the thoracic and abdominal aorta ... Dewar GA, Griffin SM, van Hasselt CA, et al.: Fatal haemoperitoneum due to liver metastases from nasopharyngeal cancer Aust N Z J of Surg 1991, 61(9):723-725 Yoshida H, Mamada Y, Taniai N, et al.:...
  • 3
  • 372
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008