transposition of mudj k into the chromosome of salmonella enterica isolation of mudj k fusions to genes by linkage to a known marker
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot
... GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA ... GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC GCAATACTCAGAGCCTTGGCGTCAGGCTCCAGAGC ... b-DG(654–750), and Asat and A0 are the absorbances at saturation and in the absence of ligand, respectively Data were normalized according to the equation (Ai ) A0 ) ⁄ (Asat ) A0 ) and reported as fractional...
- 15
- 337
- 0
Báo cáo hóa học: " Effective harvesting, detection, and conversion of IR radiation due to quantum dots with built-in charge" docx
... Bordel D, Tanabe K, Wakayama Y, Nishioka M, Arakawa Y: Fabrication of InAs/GaAs quantum dot solar cells with enhanced photocurrent and without degradation of open circuit voltage Appl Phys Lett ... Page 13 of 13 Shockley W, Queisser HJ: Detailed balance limit of efficiency of p-n junction solar cells J Appl Phys 1961, 32:510 Takamoto T, Agui T, Washio H, Takanashi N, Nakamura K, Anzawa ... calculate potential barriers, which separate the conducting states in the media from the localized QD states Taking into account the effects of the built-in-dot charge on the IR absorption and photoelectron...
- 13
- 416
- 0
Rapid transcriptome responses of maize (Zea mays) to UV-B in irradiated and shielded tissues Paula Casati and Virginia Walbot pptx
... primer) and AAGGCAGAGGCACAAAAG (reverse primer); for the RAD5 gene (AI691852): GCACAACAGCAGCTAAAC (forward primer) and interactions Data analysis Real-time PCR refereed research Maize Unigene I arrays ... 5' DNA methyltransferase gene (AW215926): CCCGCAAATTCATAGCTG (forward primer) and AGGCCAATCAGTGGAAAG (reverse primer); for the methylbinding protein gene (AI737448): ATGCAGAGCCAAATCAGC (forward ... with the correlation coefficients of the ratios greater than 0.95 in all cases (Figure 1) The mean hybridization signal strength and the standard error of the mean were calculated as an average of...
- 19
- 192
- 0
Application of high k dielectric to non volatile memory devices
... 919-922 [9] T Hara, K Fukuda, K Kanazawa, N Shibata, K Hosono, H Maejima, M Nakagawa, T Abe, M Kojima, and M Fujiu, "A 146 mm2 8-Gb NAND flash 23 Chapter Introduction to Floating Gate Flash Memory ... V) against capacitance density of 125 HfLaO and HfLaO/LaAlO3/HfLaO MIM capacitors Fig 5.22 Quadratic voltage coefficient () of MIM capacitors versus 127 capacitance density of HfLaO and HfLaO/LaAlO3/HfLaO ... HfLaO/LaAlO3/HfLaO capacitors Bench-marked results from the literature were also plotted Fig 5.23 Dependence of the Capacitance on Voltage Bias for HfLaO and 127 HLH MIM capacitors with similar capacitance...
- 165
- 184
- 0
Báo cáo y học: "Modulation of humoral immune response to oral BCG vaccination by Mycobacterium bovis BCG Moreau Rio de Janeiro (RDJ) in healthy adults" ppsx
... MBOS and RTP participated in the study design and participated in the drafting of the manuscript LRCB conceived the study, data analysis, coordination, the draft and finalisation of the manuscript ... manuscript All authors read and approved the final manuscript Acknowledgements We would like to thank all volunteers and Charles Woodrow for substantial contributions towards by making critical revising ... More than 90% of global production is made of the Russian BCG-I, Tokyo 172-1, Danish 1331, Moreau RDJ and Pasteur 1173-P2 sub strains [19] principal activator of macrophages [25] that acts in...
- 6
- 302
- 0
Application of Hydrothermal Reaction to Biodegradability Improvement of Refractory Pollutants: Structural Conversion of Di- and Trichloroacetic Acid to Biodegradable Products
... TCAA by o hydrothermal reaction at 250 C and MPa The initial biodegradability of DCAA and TCAA was almost zero Under the reaction conditions of 250 oC and MPa, biodegradability of DCAA increased ... reactor apparatus In each experiment, sample was placed into the reactor The reactor was sealed, and then the air inside was replaced with pure nitrogen gas The reactor was put into the preheated molten ... of CAAs in the field and laboratory study Initial water quality indexes of DCAA and TCAA did not change in ambient water Since the deviation of water quality indexes was less than % of each average...
- 8
- 643
- 0
Alternate strategies for conversion of waste plastic to fuels
... intramolecular attack on the double bond Panda et al [3] and Sekine, and Fujimoto [22] have proposed a free radical mechanism for the catalytic degradation (9) (2) Propagation The hydrocarbon radical ... (combustible gas) by the supply of a gasification agent (another gaseous compound) The gasification agent allows the feedstock to be quickly converted into gas by means of different heterogeneous reactions ... hydrogenation of hydrocarbon radical (olefin) and the abstraction of the H-radical from hydrocarbon or hydrocarbon radical generate radicals, and thus, enhancing degradation rate At reaction temperature...
- 8
- 537
- 0
Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc
... loop is rather flexible and will adapt to structural features of the inhibitors as well as to the packing constraints of the environment The larger and wider the features of the ligands that compete ... does to cathepsin H To illustrate this, we calculated the average distances between CA atoms of the active site cysteine and histidine residues in cathepsins B and H and the center of CA atoms of ... residues can adopt a variety of conformations, whereas the rest of the structure of cathepsin B appears to be rigid A comparison of the interaction constants of the binding of chagasin (Ki = 0.93...
- 8
- 632
- 0
Tài liệu Báo cáo khoa học: "Robust Conversion of CCG Derivations to Phrase Structure Trees" pdf
... Charniak and Mark Johnson 2005 Coarse -to ne n-best parsing and maxent discriminative reranking In Proceedings of ACL, pages 173–180 David Chiang 2000 Statistical parsing with an automatically-extracted ... P Marcus, Mary Ann Marcinkiewicz, and Beatrice Santorini 1993 Building a large annotated corpus of english: the penn treebank Computational Linguistics, 19(2):313–330 109 Takuya Matsuzaki and ... 1–5 Fei Xia, Owen Rambow, Rajesh Bhatt, Martha Palmer, and Dipti Misra Sharma 2009 Towards a multirepresentational treebank In Proceedings of the 7th International Workshop on Treebanks and Linguistic...
- 5
- 492
- 0
Tài liệu Báo cáo Y học: The binding of lamin B receptor to chromatin is regulated by phosphorylation in the RS region ppt
... similar site(s) to in the case of PKA, and thereby increases the affinity of LBR and chromatin The binding of chromatin to GST–RS beads was also stimulated by a synthetic phase cytosol and PKA (Fig ... results indicate that the increase in the affinity of NK to chromatin is an ATP-dependent reaction, and is caused by a kinase(s) in the cytosol Then, authentic protein kinase A (PKA) and calmodulin-dependent ... and then analyzed by SDS/PAGE, followed by CBB staining and autoradiography Lanes and 4, GST; lanes and 5, GST–NK; lanes and 6, GST–RS The arrowhead and double arrowhead indicate the GST–NK and...
- 11
- 563
- 0
Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx
... 5¢-TTCCTACACATTAACGAGCCTCTGC-3¢ and DS 5¢AACATCTGGCCACACACCCTAAGC-3¢; ⁄ 2flank, US 5¢-CTATTTGCTAACAGTCTGACAATAGAGTAG-3¢ and DS 5¢-GTTACATATGCAGCTAAAGCCACAAATC-3¢; mouse Rex-1: US 5¢AACTGCATCCTCTGCTTGTG-3¢ ... 5¢CACCTAAGACACTGTG GAAGAGCAG-3¢; mouseHS2 US: 5¢GGGTCTCTCTA GGAGGAAGTCCACAGG-3¢ and DS: 5¢CAGATCTAAT GACCCTAACTCTAAC-3¢; mouse bmajor US: 5¢GGT GCACCTGACTGATGCTGAGAAG-3¢and DS: 5¢GTG GTACTTGTGAGCCAGGGCAGTG3¢ ... 5¢-CCACCAGCTATCA GGGCCCAG-3¢ and DS, 5¢-GCTGCTATGCTGTGCCTC3¢; human5¢HS2: US, 5¢-TGGGGACTCGAAAATCAA AG-3¢ and DS, 5¢-AGTAAGAAGCAAGGGCCACA-3¢; humanHS2RT3: US, 5¢-GAGTCATGCTGAGGCTTAG GG-3¢ and...
- 10
- 422
- 0
Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf
... resistant to cleavage with chymotrypsin, trypsin, papain, or pronase Protozoan parasites of the genus Giardia are one of the earliest lineages of eukaryotic cells, and the Giardia protease is the ... (PAM270 matrix), modified manually and displayed using CLUSTALW and SEQVU software Motifs were analyzed by the IMPALA BLOCKS search tool using the BLOSUM62 matrix The percentage of identical amino acids ... was coeluted with the recombinant allergen after affinity purification using the mAb IG12 [18] The natural allergen Phl p was also found to be capable of degrading a synthetic substrate at a papaincleavage...
- 10
- 535
- 0
Chương 2: Sự biến đổi của thịt sau giết mổ - The Conversion of Muscle to Meat potx
... cyclase Adenylate cyclase * ATP c AMP Proteinkinase Phosphorylase b ‘ AMP Proteinkinase * Phosphorylase b * Phosphorylase a glycogen Phosphorylase a G-1-P G-6-P Axit lactic Vai trò adrenalin ... Alpha actinin vạch Z - Calpain, calpastatin & calcium activated sarcoplasmic protease) Sự phân hủy proteoglycan – liên k t sợi collagen cấu trúc màng Cường độ biến đổi tính chất thòt thời gian ... Oligo-(α-1,4 1,4) glucantransferase Giai đoạn tê cóng * Phân giải ATP hình thành phức hợp AM Dưới xúc tác M-ATPase, ATP ADP + NL co Vì Ca2+ tương đủ cao hh a M-ATPase, tiếp tục thủy phân ATP co cơ; nguồn...
- 70
- 3,049
- 30
Báo cáo khoa học: Recruitment of coregulator complexes to the b-globin gene locus by TFII-I and upstream stimulatory factor doc
... CACAGCACCACACC-3¢); and human glyceraldehyde 3-phosphate dehydrogenase (GAPDH) promoter (upstream: 5¢-ACGTAGCTCAGGCCTCAAGACCTTG-3¢, downstream: 5¢-GACTGTCGAACAGGAGGAGCAGA GA-3¢) Immunoprecipitation ... 5¢-GAGAACATCTGGGCACAC AC-3¢); human c-globin promoter (upstream: 5¢-CCTTCA GCAGTTCCACACAC-3¢, downstream: 5¢-CTCCTCTGT GAAATGACCCA-3¢); human HS3 ⁄ (upstream: 5¢-GTG ACCTCAGTGCCTCAGAA-3¢, downstream: 5¢-ACCTAT CACAGCACCACACC-3¢); ... (Amersham Pharmacia Biotech, Piscataway, NJ, USA) The primary antibodies used were the same as those used in the ChIP and immunoprecipitation assays in addition to HDAC3 (H-99) sc-11417 (Santa...
- 9
- 312
- 0
d. to stay --> b 114. A artist went to a beautiful part of the country for a holiday, and stayed pdf
... when to walk at night a wear b when c to walk d at > c 172 She made a few conventional remark about the weather a made b conventional c remark d the > c 173 She can look back on her career ... 213 All the parks are beautiful kept and are for the use and enjoyment of the people a All b beautiful c for d enjoyment > b 214 There always is nearly a crowd at the door of the theatre asking ... men did a don't b as c to d did > d 266 A Suez Canal connects the Mediterranean Sea and the Gulf of Suez and separates the continents of Africa and Asia a A b connects c separates d of > a 267...
- 28
- 2,221
- 1
Báo cáo hóa học: " Application of real-time PCR to quantify hepatitis B virus DNA in chronic carriers in The Gambia" pptx
... to participate Thanks to Adam Jeng-Barry and Alasana Bah for laboratory assistance, Joseph Bass, Yusupha Bah, Lamin Giana and Mansour Nyang for field assistance We would like to thank Adrian V ... value was adjusted to 1.5 × 108 after direct comparison to the International HBV DNA standard Data management The data obtained in the ABi real time machine after the PCR amplification and quantification ... HBeAg Quantification of HBV DNA can be useful to assess the efficacy of antiviral therapy as a more direct method of detecting viral replication than HBV serologic markers [9,10] The clinical management...
- 7
- 429
- 0
Báo cáo hóa học: " Confined conversion of CuS nanowires to CuO nanotubes by annealing-induced diffusion in nanochannels" ppt
... leading to the formation of nanoparticles instead of nanotubes [20,21] Thus, the spreading of CuO and formation of CuO layer on the nanochannel surface of AAO and the confinement offered by AAO ... spreading of CuO and formation of CuO layer on the nanochannel surface of AAO and the confinement offered by AAO nanochannels play a key role in the formation of CuO nanotubes Preliminary results ... gives a SEM top view of the CuS nanowire array after partly dissolving the AAO pore wall The nanowires tend to “stick” to each other due to capillary force Figure 2c is a typical SEM image of CuO...
- 6
- 285
- 0
Báo cáo lâm nghiệp: " Conversion of even aged forest managed under the system involving coupes to selection forest in Klepačov J. Šilhánek" docx
... into Microsoft Excel database and processed into tables and graphics by the same software The values of individual variables were allocated by tree species into diameter degrees at an interval ... Czechia and Slovakia are given by the lower inventory limit and by the fact that a majority of stands were at the beginning of the conversion The number of trees decreased on some plots in the ... the canopy closure of the stand and in the degree of the use of available space (Saniga 1996) An excessive canopy opening by the reduction of the standing volume would induce a mighty onset of...
- 11
- 325
- 0
Báo cáo toán học: "The Structure of Maximum Subsets of {1, . . . , n} with No Solutions to a + b = kc" potx
... + k S ∗ + = − + − S∗ n− n k k2 k3 k4 S∗ k − 2k + 2k − 4k + + ( 2k − 2k + − k ) + o(1) = k4 nk k − 2k + 2k − 4k + 8( 2k − 2k + − k ) = + + o(1) k4 (k − 2k − 4k) k k − 2k − 4k + = + o(1) (k − 2k − ... ≥ they gave an example 8 (k 2) of a k- sum-free set [3] of cardinality k( k−2) n + k( k2 −2) (k4 − 2k2 −4) n + O(1), which implies k −2 8 (k 2) limn→∞ f (n ,k) ≥ k( k−2) + k( k2 −2) (k4 − 2k2 −4) , and they ... that one can take n0 (k) = O (k ) It is then an easy and tedious exercise to go through the proof of Theorem and check that one can also take n1 (k) = O (k ) Next, we explain what we mean by the word...
- 16
- 268
- 0
Conversion of Decimal to any Base ppt
... base value respective to the first argument For instance, if you pass the first argument value "1101", then the second argument should take the value "2" Collapse int BaseToDecimal(string sBase, ... A sample application to test the conversion functions • • • Create a sample Windows application in Visual Studio NET In the form: a Add three label controls named label1, label2, and label3 ... Write the code in the click event of the buttons as follows: On clicking the first button, you can convert a decimal number to any base you select in the ComboBox Collapse private void button1_Click(object...
- 5
- 215
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose