transactions an opening deposit and a withdrawal but in this category of account the money was left for at least two years this type of account usage is referred to as the lump sum deposit
a study of grammatical and lexical cohesive devices in some written discourses from the course book english for chemistry = nghiên cứu phương tiện liên kết ngữ pháp và từ vựng thông qua một số văn bản
... establishment and maintenance of human relationship (interactional use) and the latter with the working out and transferring of information (transactional use) (Brown and Yule,1983:13) This study ... Moreover, Halliday and Hasan (1976: 38) states that the Theme is the starting point for the message; it is the ground for which the clause is taking off” and “if the message is organized as a Theme-Rheme ... chemical and physical changes it undergoes, and the energy changes that accompany those processes Matter is any thing that has mass and occupies space The changes that matter undergoes always involve...
- 75
- 1,555
- 5
A study of grammatical and lexical cohesive devices in some written discourses from the course book “english for chemistry”
... understand a reading text, the readers need to pay attention to not only vocabulary and grammar but also other factors that create links between the ideas in the text, i.e cohesive devices Since a ... learners in teaching and learning English, i.e learning English is learning vocabulary and grammar Moreover, students often learn words in isolation, not in combinations Meanwhile, in order to understand ... concept of ESP and ESP discourse - describing and analyzing grammatical and lexical cohesive devices in the course book of EC for second year students in Faculty of Chemistry at HNUE The findings are...
- 9
- 796
- 6
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx
... (5Â-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3Â) was designed to insert a ClaI restriction site at nucleotide position )6, whereas the reverse primer (5Â-ATCGCCATGGTCCCGGGCATATGGGATC CCTGGAAGTACAGGTTTTCCTTTTTAATGGGTGTC ... because isolated NTAIL is less extended than isolated PNT The structural disorder and exibility typical of isolated NTAIL is maintained and appears to increase in the fusion, resulting in a Stokes ... analyzed by MS MS (Fig S3) The Mr, as determined by MS, of band a from NTAIL-GFP was 31.6 kDa and that of band b from PNT-GFP was 30.8 kDa Sequencing showed that these protease-resistant fragments...
- 14
- 672
- 0
Báo cáo khoa học: "Consequences of an excess Al and a deficiency in Ca and Mg for stomatal functioning and net carbon assimilation of beech leaves" ppt
... between +Al (–31%) and –CaMg (–43%) treatments An interaction between excess Al and a deficiency in Ca and Mg was calculated for +Al–CaMg plants (–70%) The decrease in A was accompanied by a constancy ... s-1) Aluminium, stomata and photosynthesis in beech of both chl a and chl b concentrations was recorded in the leaves of +Al, –CaMg and +Al–CaMg plants to about 40% of the control values The ratio ... vitality via a disturbance in stomatal regulation and leaf carbon assimilation In beech seedlings exposed to aluminium, Al accumulated in the parenchyma, and palisade cells always showed higher Al concentration...
- 10
- 376
- 0
Báo cáo y học: " A woman with cystic fibrosis, severe hypoxaemia, an atrial thrombus and a patent foramen ovale: a case report" pdf
... revealed a right -to -left intracardiac shunt as a result of a patent foramen ovale (PFO) and a right atrial thrombus Case presentation A 21-year-old Caucasian woman with CF, rheumatoid arthritis ... event in the context of a TIVAD, a PFO and lupus anticoagulants Initially, the hypoxaemia was attributed to an infective exacerbation, but other diagnoses were later considered as oxygen saturation ... arthritis (RA) and a TIVAD presented with deterioration in her oxygen saturation, from a baseline of 95%, to 88% in room air This was attributed to an infective exacerbation as her forced expiratory...
- 4
- 267
- 0
Báo cáo y học: "Anticitrullinated protein antibody (ACPA) in rheumatoid arthritis: influence of an interaction between HLA-DRB1 shared epitope and a deletion polymorphism in glutathione s-transferase in a cross-sectional study" ppt
... research support from the VHA (VA Merit) and the American College of Rheumatology Research and Education Foundation The authors thank Debra Bergman and Bart Hamilton for their assistance in this ... modification Bang et al [43] have shown that oxidation of citrullinated vimentin, implicated as an autoantigen in RA, leads to substantially increased antibody reactivity to this antigen in RA Our ... Cornelis MC, Bae SC: Glutathione S-transferase M1, T, and P1 genotypes and rheumatoid arthritis J Rheumatol 2005, 32:992-997 Ghelani AM, Samanta A, Jones AC, Mastana SS: Association analysis of TNFR2,...
- 10
- 338
- 0
Báo cáo khoa học: "limits for blood delivery via femoral vein access and a potential alternative in an experimental setting in anesthetized pigs" pps
... significant if data analysis could have been based on real Qb measurements Another limitation is the lack of randomized allocation of animals to the catheter groups On the other hand, our setting ... SMN and A- JL performed CT scans and detailed analyses of catheter positioning and blood vessels and participated in drafting the manuscript KP, RCF, MMT, and JB all significantly participated in ... http://ccforum.com/content/11/1/R18 (AccuImage Diagnostics Corporation, South San Francisco, CA, USA) Statistical analysis Data were analyzed using Sigma STAT 3.1 and Sigma Plot 8.0 for Windows (Systat Software GmbH, Erkrath,...
- 11
- 263
- 0
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
... Change in pattern Change in pattern a Theoretical values b F and P refer to ANOVA c Identified from SWISS 2D-PAGE database dehydrogenase and to mitochondrial ATP synthase a subunit by comparison ... (Bruker-Daltonik, Bremen, Germany) Capillary voltage was 1.5–2 kV and a dry gas flow rate of 10 LÆmin)1 was used with a temperature of 230 °C The scan range was 300–1800 m ⁄ z The tandem mass spectra ... the actin bundles regulator fascin [27] and discordant changes 4914 of two calcium-dependent, actin-associated proteins (annexins A2 and A5 ), both regulating membrane dynamics, cell migration,...
- 11
- 775
- 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... primer 5¢-d(TATTTGCATGGCC AGCCCAATCTATTTGAG)-3¢; Gly262 to Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCA CCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper ... for 30 The remaining activity was measured at 20 °C Reported values are the average of at least two measurements The standard deviations not exceed 10% Expression and purification of enzymes The...
- 6
- 488
- 0
Báo cáo khoa học: Starch-binding domains in the CBM45 family – low-affinity domains from glucan, water dikinase and a-amylase involved in plastidial starch metabolism pptx
... Solanum tuberosum a- glucan, water dikinase (StGWD) and the A thaliana plastidial a- amylase (AtAMY3), suggesting that the evolution of low-affinity domains is a recurring and functionally important ... Binding of AtAMY3 to tobacco leaf starch in vitro Recombinant AtAMY3 protein was incubated with starch isolated from leaves of Nicotiana benthamiana for 45 at °C Unbound protein was assayed for activity ... recombinant AtAMY3 was demonstrated by incubation with starch isolated from leaves of tobacco plants Binding was carried out at °C and the a- amylase activity of the unbound fraction was subsequently...
- 11
- 634
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... and have the AAA domain helix and the C-terminal helix, but not the b domain The distinguishing feature of members of the meiotic clade of AAA ATPases is the SRH motif, which differs from that ... from other Walker -type ATPases [21] A pair of conserved Arg residues within this motif activate ATPase activity in an adjacent ATPase domain [22,23] and have also been shown to be important for...
- 23
- 490
- 0
Báo cáo khoa học: Apolipoproteins A-I and A-II are potentially important effectors of innate immunity in the teleost fish Cyprinus carpio pot
... evaluate the presence of the peptide in the mucus and plasma of pathogen-challenged fish Given that anti -in ammatory, antiviral, antibacterial activities have been reported for mammalian HDL and ... (D) using a specific anti-apoA-II serum Fig 4B, the intact apoA-I (band a) , an intermediary fragment (band b) and a more stable third band (band c) were recognized by the specific antiserum against ... bovine pancreas chymotrypsin at 37 °C using a molar ratio of protease to lipoprotein (1 : 100) and taking aliquots each 30 over h The reaction was stopped by heating the samples at 100 °C for in...
- 7
- 397
- 0
Báo cáo khoa học: DYRK1A phosphorylates caspase 9 at an inhibitory site and is potently inhibited in human cells by harmine pptx
... initiates a proteolytic cascade by processing and activating downstream effector caspases such as caspase and caspase 7, leading to the organized disassembly of the cell [11] Regulation of apoptosome ... caspase 9(C28 7A) as a substrate Active DYRK 1A produced in bacteria catalysed the incorporation of radiolabelled phosphate into caspase 9, whereas a caspase mutant in which Thr125 was mutated to ... this way, a nuclear kinase, DYRK 1A, can regulate the cytoplasmic activity of caspase as an initiator of apoptosis It does, however, remain possible that caspase has a distinct function within the...
- 13
- 317
- 0
Báo cáo khoa học: The isopenicillin N acyltransferases of Aspergillus nidulans and Penicillium chrysogenum differ in their ability to maintain the 40-kDa ab heterodimer in an undissociated form pdf
... Note the presence of the 40-kDa band and the absence of the 11-kDa IAT band in the A nidulans extracts penDE gene was introduced into this fungus which lacks IAT [4] IAT of P chrysogenum and A nidulans ... whereas the A nidulans enzyme remained in the 40-kDa form for at least 96 h of incubation No peptidases able to cleave IAT were found in the fungal extracts This indicates that processing of P ... chrysogenum introduced into the same host strains Constructions for expressing the A nidulans IAT a and b subunits and the ab proacyltransferase in E coli As the 40-kDa proacyltransferase of P chrysogenum...
- 11
- 423
- 0
Báo cáo sinh học: " Maternal plasma viral load and neutralizing/enhancing antibodies in vertical transmission of HIV: A non-randomized prospective study" potx
... none of the values was statistically significant Maternal viral load and enhancing antibodies as predictors of vertical transmission of HIV Univariate analysis of type of treatment, stage of HIV ... transmission of HIV-1 was examined in a multivariable model Log viral load was treated as a continuous variable in the model and enhancement was categorized as enhancement versus neutralization There was ... levels The number of HIV vertical transmission among infants was summarized and the univariate association of maternal characteristics, such as, treatment (type of antiretroviral therapy), stage of...
- 10
- 315
- 0
báo cáo hóa học:" Maternal plasma viral load and neutralizing/enhancing antibodies in vertical transmission of HIV: A non-randomized prospective study" ppt
... none of the values was statistically significant Maternal viral load and enhancing antibodies as predictors of vertical transmission of HIV Univariate analysis of type of treatment, stage of HIV ... transmission of HIV-1 was examined in a multivariable model Log viral load was treated as a continuous variable in the model and enhancement was categorized as enhancement versus neutralization There was ... levels The number of HIV vertical transmission among infants was summarized and the univariate association of maternal characteristics, such as, treatment (type of antiretroviral therapy), stage of...
- 10
- 437
- 0
Báo cáo sinh học : "The genomic ‘inner fish’ and a regulatory enigma in the vertebrates." docx
... has erased the vestiges intermediates in the vertebrates sampled Since Cuvier, careful cataloging of anatomy in the context of phylogeny and development has had a major impact on our understanding ... vast bulk of comparative anatomy data reveals the deep roots of tissues and organ systems Morphology indicates that the basic sensory, digestive, reproductive and excretory functions in animals ... the idea that similar organs should express similar genes The logical idea that coexpression and co-regulation are linked was one of the early driving forces behind DNA microarray analysis, but...
- 4
- 265
- 0
Báo cáo lâm nghiệp: "Processes of loss, recruitment, and increment in stands of a primeval character in selected areas of the Pieniny National Park (southern Poland" ppt
... sylvatica Other Abies alba Fagus sylvatica 57 45 Fagus sylvatica and other broadleaves Abies alba 456 12 102 93 147 410 Abies alba Fagus sylvatica and other broadleaves Abies alba Fagus sylvatica and ... that of fir had decreased (Table 2), and that beech proportion in increment was greater than it proportion in basal area and stand volume (Tables and 4) According to studies of Priesol and Hladík ... tree was 1.38 m3 Volume increment reached about 9.4 m3/ha/year (Table 2), and the ratio between annual volume loss and stand volume in 1997 was 1.4% (Table 3) Mean annual basal area increment was...
- 12
- 362
- 0
Báo cáo y học: "Relationship among Dexamethasone Suppression Test, personality disorders and stressful life events in clinical subtypes of major depression: An exploratory study" pot
... effect, it is interesting that there are papers in the international literature suggesting that conditions of internal conflict increase DA activity and lead to the appearance of displacement activities, ... Iacovides A, Ioannidou C, Bascialla F, Nimatoudis I, Kaprinis G, Janca A, Dahl A: Reliability and cultural applicability of the Greek version of the International Personality Disorders Examination BMC ... I: Basal Plasma Levels Archives of General Psychiatry 1985, 42:904-908 American Psychiatric Associatrion: Diagnostic and Statistical Manual of Mental Disorders, 4th Edition DSM-IV Washington...
- 8
- 415
- 0
báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx
... functioning endocrine tumor in the body and tail of the pancreas and (iv) functioning bilateral adrenal tumors, was established The patient was submitted to an exploratory laparotomy through a bilateral ... observations (especially that the proliferation index was about 5%) as well as the data from the literature, the diagnosis of well-differentiated endocrine carcinoma of the pancreas was established ... present only in the tumor of the left adrenal gland Immunohistochemically, the cells were MelanA and synaptophysin immunopositive No immunostaining for cytoceratin, chromogranin, EMA and CEA was observed...
- 7
- 412
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008