toxic movement disorders the approach to the patient with a movement disorder of toxic origin pdf
Chapter 052. Approach to the Patient with a Skin Disorder (Part 1) ppt
Ngày tải lên :
06/07/2014, 20:20
... 52-3) and to formulate a differential diagnosis (Table 52-4) For instance, the finding of scaling papules (present in patients with psoriasis or atopic dermatitis) places the patient in a different ... raised, often translucent lesion >0.5 cm in diameter Wheal: A raised, erythematous, edematous papule or plaque, usually representing short-lived vasodilatation and vasopermeability Telangiectasia: ... lesions If the examiner focuses on linear erosions overlying an area of erythema and scaling, he or she may incorrectly assume that the erosion is the primary lesion and the redness and scale are secondary,...
- 5
- 413
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 2) potx
Ngày tải lên :
06/07/2014, 20:20
... or character Sites on hair-bearing areas may be characterized by destruction of hair follicles Table 52-3 Common Dermatologic Terms Alopecia: Hair loss; it may be partial or complete Annular: ... that elicits the desire to scratch Pruritus is often the predominant symptom of inflammatory skin diseases (e.g., atopic dermatitis, allergic contact dermatitis); it is also commonly associated ... and are caused by scratching Atrophy: An acquired loss of substance In the skin, this may appear as a depression with intact epidermis (i.e., loss of dermal or subcutaneous tissue) or as sites of...
- 5
- 334
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 4) doc
Ngày tải lên :
06/07/2014, 20:20
... lesions, the shape of individual lesions, and the arrangement of the lesions An ideal skin examination includes evaluation of the skin, hair, and nails as well as the mucous membranes of the mouth, ... erythematous exanthem is more likely to have a drug eruption than is a patient with a similar rash limited to the sun-exposed portions of the face Once the distribution of the lesions has been established, ... lesions and make it possible to assess the distribution of the eruption accurately The patient should first be viewed from a distance of about 1.5–2 m (4–6 ft) so that the general character of the...
- 5
- 414
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 5) pptx
Ngày tải lên :
06/07/2014, 20:20
... A D The distribution of some common dermatologic diseases and lesions Figure 52-7 Psoriasis This papulosquamous skin disease is characterized by small and large erythematous papules and plaques ... skin disease is characterized by small and large erythematous papules and plaques with overlying adherent silvery scale Figure 52-8 ...
- 5
- 321
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 6) pdf
Ngày tải lên :
06/07/2014, 20:20
... contact (Fig 52-10) or primary irritant dermatitis In contrast, lesions with a generalized arrangement are common and suggest a systemic etiology Figure 52-9 Erythema multiforme This ... This eruption is characterized by multiple erythematous plaques with a target or iris morphology It usually represents a hypersensitivity reaction to drugs (e.g., sulfonylamides) or infections ... reaction to drugs (e.g., sulfonylamides) or infections (e.g., HSV) (Courtesy of the Yale Resident's Slide Collection; with permission.) Figure 52-10 ...
- 5
- 319
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 7) ppt
Ngày tải lên :
06/07/2014, 20:20
... melanoma, atopy, psoriasis, or acne) 10 Social, sexual, or travel history as relevant to the patient DIAGNOSTIC TECHNIQUES Many skin diseases can be diagnosed on gross clinical appearance, but ... malaise, fever, arthralgias) Ongoing or previous illnesses History of allergies Presence of photosensitivity Review of systems Family history (particularly relevant for patients with melanoma, atopy, ... superficial anatomic structures in selected areas of the body In this procedure, a small area of skin is anesthetized with 1% lidocaine with or without epinephrine The skin lesion in question can be...
- 5
- 398
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 8) pptx
Ngày tải lên :
06/07/2014, 20:20
... noting the amount of blanching that occurs Granulomas often have an opaque to transparent, brown-pink "apple jelly" appearance on diascopy Figure 52-11 Urticaria Discrete and confluent, edematous, ... erythematous papules and plaques are characteristic of this whealing eruption Wood's Light A Wood's lamp generates 360-nm ultraviolet (or "black") light that can be used to aid the evaluation of ... under a Wood's lamp, and previously unsuspected areas of involvement often become apparent A Wood's lamp may also aid in the demonstration of tinea versicolor and in recognition of ash leaf spots...
- 5
- 367
- 0
Strengthening the Education Sector Response to School Health, Nutrition and HIV/AIDS in the Caribbean Region: A Rapid Survey of 13 Countries pdf
Ngày tải lên :
14/03/2014, 20:20
... implementation In Trinidad and Tobago, the strategy recently expired The Bahamas, St Lucia, and St Vincent and the Anguilla Antigua The Bahamas Barbados Belize Dominica Grenada Guyana Jamaica St ... Guyana, Jamaica and Trinidad and Tobago, support is given to a Sector Wide Approach (SWAP) in education with one national sectoral plan including all education sub-sectors in a country The SWAP ... (see Table 10) Of these eight countries, five reported the absence of an Support to MoE SHN and HIV/AIDS Responses Anguilla Antigua The Bahamas Barbados Belize Dominica Grenada Guyana Jamaica St...
- 40
- 450
- 0
Báo cáo hóa học: " The happiness of people with a mental disorder in modern society" pdf
Ngày tải lên :
21/06/2014, 06:20
... Veenhoven et al 2011) This leads to a somewhat paradoxical conclusion that people with mental disorders are happy if they have the characteristics that are usually associated with good mental health ... honest about their happiness However, the data not support this explanation Happiness of people with and without mental disorders turn out to be associated in the same way with other indicators of ... well with the idea put forward by Horwitz and Wakefield (2006) that the high levels of mental disorders in the general population may be a survey artifact A lot of people who are diagnosed as having...
- 6
- 340
- 0
Chapter 077. Approach to the Patient with Cancer (Part 1) potx
Ngày tải lên :
07/07/2014, 01:20
... remain functional and maintain a self-image as a fully intact person with just a malfunctioning part, a diseased organ ( "a bum ticker") By contrast, the patient with pancreatic cancer has a completely ... pain takes on desperate significance Cancer is an exception to the coordinated interaction among cells and organs In general, the cells of a multicellular organism are programmed for collaboration ... collaboration Many diseases occur because the specialized cells fail to perform their assigned task Cancer takes this malfunction one step further Not only is there a failure of the cancer cell to maintain...
- 8
- 275
- 0
Chapter 077. Approach to the Patient with Cancer (Part 3) pptx
Ngày tải lên :
07/07/2014, 01:20
... reveal the chronicity of disease The past medical history may alert the physician to the presence of underlying diseases that may affect the choice of therapy or the side effects of treatment The ... and personal and family history Particular attention should be focused on ruling out the most treatable causes (Chap 95) Once the diagnosis of cancer is made, the management of the patient is ... procedure, the diagnosis generally depends on obtaining adequate tissue to permit careful evaluation of the histology of the tumor, its grade, and its invasiveness and to yield further molecular diagnostic...
- 5
- 306
- 0
Chapter 077. Approach to the Patient with Cancer (Part 4) pps
Ngày tải lên :
07/07/2014, 01:20
... by the International Union Against Cancer and the American Joint Committee on Cancer (AJCC) The TNM classification is an anatomically based system that categorizes the tumor on the basis of the ... Performance Functional Capability of the Patient 100 Normal; no complaints; no evidence of disease 90 Able to carry on normal activity; minor signs or Status symptoms of disease 80 Normal activity with ... particular tumors for spread to adjacent or distant organs helps direct the staging evaluation Information obtained from staging is used to define the extent of disease either as localized, as...
- 6
- 265
- 0
Chapter 077. Approach to the Patient with Cancer (Part 5) doc
Ngày tải lên :
07/07/2014, 01:20
... regular examinations, and taking time to talk 2 The National Cancer Institute maintains a database called PDQ (Physician Data Query) that is accessible on the Internet under the name CancerNet at ... complications of both the disease and its treatment as well as the complex psychosocial problems associated with cancer In the short term during a course of curative therapy, the patient' s functional ... neutropenia (Chap 82), and myelosuppression (Chap 81) Tools are now available to minimize the acute toxicity of cancer treatment New symptoms developing in the course of cancer treatment should always...
- 5
- 281
- 0
Chapter 077. Approach to the Patient with Cancer (Part 6) pdf
Ngày tải lên :
07/07/2014, 01:20
... Medullary cancer of the thyroid Catecholamines Pheochromocytoma Oncofetal Antigens Alphafetoprotein Hepatocellular carcinoma, gonadal germ Cirrhosis, cell tumor Carcinoembryonic antigen Adenocarcinomas ... Adenocarcinomas hepatitis Pancreatitis, of the colon, pancreas, hepatitis, lung, breast, ovary inflammatory bowel disease, smoking Enzymes Prostatic acid Prostate cancer phosphatase Prostatitis, prostatic ... enolase Lactate dehydrogenase Small cell cancer of the lung,neuroblastoma Lymphoma, Ewing's sarcoma Hepatitis, hemolytic many others Tumor-Associated Proteins anemia, Prostate-specific Prostate...
- 5
- 295
- 0
Chapter 077. Approach to the Patient with Cancer (Part 7) ppt
Ngày tải lên :
07/07/2014, 01:20
... Studies of breast cancer, melanoma, lung cancer, colon cancer, and lymphoma have all failed to support the notion that asymptomatic relapses are more readily cured by salvage therapy than symptomatic ... that patients are more likely to discuss with the physician what they are actually doing The appearance of unexpected toxicity may be an indication that a supplemental therapy is being taken.3 ... year, every months for a year, every months for a year, every months for a year, and then annually At each visit, a battery of laboratory and radiographic and imaging tests were obtained on the...
- 5
- 398
- 0
Chapter 077. Approach to the Patient with Cancer (Part 8) potx
Ngày tải lên :
07/07/2014, 01:20
... dynamic, making it necessary to reassess the patient frequently Pain therapy should not be withheld while the cause of pain is being sought A variety of tools are available with which to address cancer ... few patients will have inadequate pain relief if appropriate measures are taken A specific approach to pain relief is detailed in Chap 11 Nausea Emesis in the cancer patient is usually caused ... be related to bowel inflammation from the therapy and can be controlled with oral dexamethasone and oral metoclopramide, a dopamine receptor antagonist that also blocks serotonin receptors at high...
- 5
- 288
- 0
Chapter 077. Approach to the Patient with Cancer (Part 11) pot
Ngày tải lên :
07/07/2014, 01:20
... affect the course of treatment Cancer survivors have other sets of difficulties Patients may have fears associated with the termination of a treatment they associate with their continued survival Adjustments ... Despite the fear of disseminating tumor cells into the circulation, widespread metastases are an unusual complication The major complications are occlusion, leakage, and fluid overload Patients with ... acetate, a progestational agent, has been advocated as a pharmacologic intervention to improve nutritional status Research in this area may provide more tools in the future as cytokine-mediated...
- 5
- 265
- 0
Chapter 077. Approach to the Patient with Cancer (Part 12) pot
Ngày tải lên :
07/07/2014, 01:20
... how the patient has been affected by the diagnosis and is coping with it is an important goal of patient management It is best to speak frankly with the patient and the family regarding the likely ... acknowledgment of an incurable disease, and the goal of palliative therapy is embraced in the hope of being able to live with disease; finally, at the disclosure of imminent death, another adjustment ... course of disease These discussions can be difficult for the physician as well as for the patient and family The critical features of the interaction are to reassure the patient and family that everything...
- 5
- 284
- 0
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot
Ngày tải lên :
16/03/2014, 12:20
... GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA ... GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC GCAATACTCAGAGCCTTGGCGTCAGGCTCCAGAGC ... 5¢-AGTGTTGTTGGTCGCTTCCAC CAC-3¢ (Trp659 fi Ala), 5¢- GGGGCAGGGCGCCAG GGGCAGAG-3¢ (Glu667 fi Ala), 5¢-AGCATTGGAGGC GGCAGGACGAGGC-3¢ (Phe692 fi Ala), and 5¢-TCA GAGCCTTAGCGTCAGGCTCCAG-3¢ (Phe700 fi Ala) The megaprimers...
- 15
- 337
- 0