tnfα monoclonal antibodies combinatorial treatment inhibits autoimmune disease in a murine model of systemic lupus erythematosus

 Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"

Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"

Ngày tải lên : 25/10/2012, 09:56
... Jan Nystuen from the area of Innlandet, Unni Eskeland and Olav Østebø from the area of Stavanger, and Leif Landa, Kari Hauge Nilsen, and Trond Kibsgaard in the area of Haugesund We want to thank ... medical treatment, NACA 2-3, indicating need of medical help where value indicates need of hospitalisation, but still not a life-threatening situation NACA 4-6 indicates potentially (4) and definitely ... one was dead The 256 extra patients, all interrupted missions, allocations of ambulances, and support to Zakariassen et al Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine...
  • 9
  • 784
  • 0
Báo cáo y học: "The epidemiology of intensive care unit-acquired hyponatraemia and hypernatraemia in medical-surgical intensive care unit"

Báo cáo y học: "The epidemiology of intensive care unit-acquired hyponatraemia and hypernatraemia in medical-surgical intensive care unit"

Ngày tải lên : 25/10/2012, 10:31
... help clinicians identify patients at increased risk An elevated baseline creatinine was associated with a 50% increased risk of ICU-acquired hypernatraemia and may be a marker of impaired renal sodium ... ICU-acquired hyponatraemia and hypernatraemia varies according to patient characteristics • ICU-acquired hyponatraemia and hypernatraemia are associated with increased risk of hospital mortality ... ICU-acquired hypernatraemia has twice the incidence of hyponatraemia and that patients with surgical and neurological/trauma diagnoses are at increased risk of developing hyponatraemia compared...
  • 8
  • 721
  • 0
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"

Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"

Ngày tải lên : 02/11/2012, 09:56
... virus infection in hemodialysis patients and the general population in Fukuoka and Okinawa, Japan J Gastroenterol 1994;29:276–281 61 Qadi AA, Tamim H, Ameen G, Bu-Ali A, Al-Arrayed S, Fawaz NA, Almawi ... and HTLV-1 in Sherpas of Nepal Asian Pac J Cancer Prev 2004; 5(4):370-3 30 Panigrahi AK, Panda SK, Dixit RK, Rao KV, Acharya SK, Dasarathy S, Nanu A Magnitude of hepatitis C virus infection in ... 1994;14:253–258 22 Wang Y, Tao QM, Zhao HY, Tsuda F, Nagayama R, Yamamoto K, Tanaka T, Tokita H, Okamoto H, Miyakawa Y, et al Hepatitis C virus RNA and antibodies among blood donors in Beijing J Hepatol 1994;21:...
  • 6
  • 486
  • 0
PRONUNCIATION ENGLISH PROBLEM OF IBD STUDENTS

PRONUNCIATION ENGLISH PROBLEM OF IBD STUDENTS

Ngày tải lên : 15/04/2013, 13:51
... co-operated and established diplomatic relations with 168 countries in all continents In addition, Vietnam has also participated in many large organizations such as, ASEAN, APEC, ASEM and more than ... conversations, the ways of native speaker’ pronunciation impact on listeners’ organ of hearing Gradually, the organ of hearing gets acquainted to that ways of pronunciation, which makes capacity of correct ... English as well as many chances to approach acquainted with English The biggest advantage of English learners is that the government is concerning and investing in teaching English The clearest...
  • 28
  • 745
  • 3
CLINICAL EPIDEMIOLOGY OF ACUTE LYMPHOBLASTIC LEUKEMIA - FROM THE MOLECULES TO THE CLINIC docx

CLINICAL EPIDEMIOLOGY OF ACUTE LYMPHOBLASTIC LEUKEMIA - FROM THE MOLECULES TO THE CLINIC docx

Ngày tải lên : 17/03/2014, 12:20
... MejiaArangure, David Aldebarán Duarte-Rodríguez, Juan Manuel Mej a- Aranguré, Arturo Fajardo-Gutierrez, Richard McNally, Patricia Perez-Vera, Roman Crazzolara, Maria Luisa Perez-Saldivar, Angélica ... RiveraLunaR, Palomo-ColliMA, Romero-GuzmanL , Perez-VeraP , Alvarado-IbarraM, Salamanca-GómezF, Fajardo-Gutierrez A, Mej a- AranguréJM Breastfeeding and ear‐ ly infection in the aetiology of childhood ... Patricia, Borgas Cesar, Zùñiga Guillermo, Puebla Ana Maria, Luis Figuera, Garcia Juan Ramon, Haitao Zhu, Dongqing Wang, Shoko Kobayashi, Ezequiel M Fuentes-Pananá, Abigail Morales-Sanchez, Juan Manuel...
  • 342
  • 1K
  • 0
Epidemiology of hypertension in the elderly pptx

Epidemiology of hypertension in the elderly pptx

Ngày tải lên : 28/03/2014, 19:21
... statistics.gr 38 Voukiklaris GE, Kafatos A, Dontas AS Changing prevalence of coronary heart disease risk factors and cardiovascular diseases in men of rural area of Crete from 1960 to 1991 Angiology 1996;47(1):43-49 ... Menotti A, Lanti M, Kafatos A, Nissinen A, Dontas A, Nedeljkovic S, et al The role of a baseline casual blood pressure measurement and of blood pressure changes in middle age in prediction of cardiovascular ... During the last years, hypertension treatment has led to an important decrease of cardiovascular mortality and to a delayed progression of renal disease development Secondary hypertension accounts...
  • 7
  • 545
  • 0
Báo cáo khoa học  Epidemiology of EMS/AHPNS based on September 2012 cross sectional studies 2013

Báo cáo khoa học Epidemiology of EMS/AHPNS based on September 2012 cross sectional studies 2013

Ngày tải lên : 13/05/2014, 15:29
... significant by chance – Confounding bias • Can not doing on multivariate analysis due to unavailable data and missing data • A lot of missing data – Indicate low quality of information i.e farmer forgot, ... cooperation • Bac Lieu Aquaculture, Ca Mau Sub Animal health and Soc Trang sub animal Health for working infield to collected the data • A team of data input Thank you for your attention ... (since January 2012 to the date of doing the questionnaire) Survey data • Questionnaire • Part 1: General respondent (farmer) information • Part General farm information* • Part General pond information*...
  • 29
  • 251
  • 0
Báo cáo hóa học: " On the epidemiology of influenza" pdf

Báo cáo hóa học: " On the epidemiology of influenza" pdf

Ngày tải lên : 20/06/2014, 01:20
... of the population with both impaired innate and inadequate adaptive immunity may explain the abrupt disappearance of influenza Impairments in innate immunity may also increase transmission, in ... the first case was the index case The best-known case is an airliner in Alaska, where an extensive outbreak of influenza occurred after an infected patient appeared among Page of 12 (page number ... vaccination coverage from ~10% to ~60%" [10] Given that influenza vaccinations increase adaptive immunity, why don't epidemiological studies show increasing vaccination rates are translating into...
  • 12
  • 461
  • 0
Báo cáo hóa học: " Epidemiology of foot-and-mouth disease in Landhi Dairy Colony, Pakistan, the world largest Buffalo colony" pptx

Báo cáo hóa học: " Epidemiology of foot-and-mouth disease in Landhi Dairy Colony, Pakistan, the world largest Buffalo colony" pptx

Ngày tải lên : 20/06/2014, 01:20
... isolates PanAsia related isolates from Turkey PanAsia II related isolates from Bhutan/Nepal root for subtree PanAsia II related isolates from Pakistan PanAsia lineage PanAsia II related isolates ... [14] We thank Tina Pedersen, Tina Frederiksen, Jane Borch, Jani Christiansen, Syed Jamal, Abubakar, Liaquat Ali, Hassan Tanweer, Abdul Hafeez Sheikh, Mehmood Iqbal, Manzoor Asif, Zaka Nazamani for ... neighbouring countries of India, Afghanistan, Iran and China [7-9] and those serotypes are a continued problem in Pakistan According to the OIE HandiSTATUS [10] Pakistan considers itself as having a...
  • 16
  • 287
  • 0
Molecular Epidemiology of Microorganisms pps

Molecular Epidemiology of Microorganisms pps

Ngày tải lên : 05/07/2014, 02:20
... TCTGCGTTCCGCCAAGTTCGA FIC repA2 262 F R GTGAACTGGCAGATGAGGAAGG TTCTCCTCGTCGCCAAACTAGAT A/ C repA 465 F R GAGAACCAAAGACAAAGACCTGGA ACGACAAACCTGAATTGCCTCCTT P-1 alpha Iterons 534 F R CTATGGCCCTGCAAACGCGCCAGAAA ... CTCCCGTCGCTTCAGGGCATT Y repA 765 F R AATTCAAACAACACTGTGCAGCCTG GCGAGAATGGACGATTACAAAACTTT I1 RNAI 139 F R CGAAAGCCGGACGGCAGAA TCGTCGTTCCGCCAAGTTCGT F RNAI/repA 270 F R TGATCGTTTAAGGAATTTTG GAAGATCAGTCACACCATCC ... CTATGGCCCTGCAAACGCGCCAGAAA TCACGCGCCAGGGCGCAGCC T repA 750 F R TTGGCCTGTTTGTGCCTAAACCAT CGTTGATTACACTTAGCTTTGGAC K/B RNAI 160 F R GCGGTCCGGAAAGCCAGAAAAC TCTTTCACGAGCCCGCCAAA W repA 242 F R CCTAAGAACAACAAAGCCCCCG...
  • 323
  • 109
  • 0
molecular epidemiology of tuberculosis in viet nam (2003-2009)

molecular epidemiology of tuberculosis in viet nam (2003-2009)

Ngày tải lên : 25/07/2014, 13:57
... distribution of M tuberculosis in East Asia as showed in theinternational spoligotyping database Among the sub-lineages of EAI lineage, EAI4-VNM is a special sublineage for Vietnam,accounted for 67% of ... proportion of isolates belong the ancestral EAIlineage increased from India through Southeast Asia andpredominatedin Southeast Asia .In 20 21 each country, different EAI sub-lineages were circulating at ... through Indiato Southeast Asia.That was whythe highest proportion of EAI5 sub-lineage was found in Southeast Asia Beijing lineage was originated from Centre Asia It thenspread to North and East Asia...
  • 15
  • 301
  • 0
epidemiology of, and risk factors on pandemic influenza ah1n12009 in the northern area of vietnam, 2009 - 2011

epidemiology of, and risk factors on pandemic influenza ah1n12009 in the northern area of vietnam, 2009 - 2011

Ngày tải lên : 25/07/2014, 13:57
... with captaining genes from avian influenza, North American swine influenza, human influenza, and two swine influenza viruses found in Asia and Europe The origin and development of the pandemic: ... questionnaires 2.4 Data analysis - - Using Stata version 9.2 (StataCorp USA) for univariate analysis and conditional logistics analysis, stepwise approach with pe = 0,2 for the optimal model Using Arc ... infection A research in China shows that the possibility of infection of the age group under 18 years was 15 times as high as that of the group aged 18 years and over Besides this, a study in Japan also...
  • 27
  • 451
  • 0
epidemiology of nosocomial pneumonia in the intensive care unit of bach mai hospital, 2008-2009

epidemiology of nosocomial pneumonia in the intensive care unit of bach mai hospital, 2008-2009

Ngày tải lên : 25/07/2014, 13:57
... characteristics of A baumannii causing HAP 4.2.1 HAP Pathogens Recent decades have seen a swing in the pattern of infecting organisms towards gram-negative infections such as P aeruginosa, Acinetobacter ... compliance of HCWs with aseptic techniques 1.2 Antibiotic resistance characteristics of bacteria causing HAP Growing cause of HAP including Acinetobacter baumannii, P.aeruginosa which are associated ... (2) HAP is caused by bacteria from adjadcent aer subdiaphragmatic abscesseas of lungs (subdiaphragmatic abscess, mediastinal abscess, pleural infection v.v), (3) Aspiration of oropharyngeal bacteria...
  • 26
  • 337
  • 0
Báo cáo sinh học: "Molecular epidemiology of clinical and carrier strains of methicillin resistant Staphylococcus aureus (MRSA) in the hospital settings of north India" pptx

Báo cáo sinh học: "Molecular epidemiology of clinical and carrier strains of methicillin resistant Staphylococcus aureus (MRSA) in the hospital settings of north India" pptx

Ngày tải lên : 08/08/2014, 19:20
... to all tested antimicrobial agents except for pencillin, ampicillin and co-trimoxozable Our observation was that resistance in carrier isolates was lesser than clinical strains in case of all antibiotics ... http://www.ann-clinmicrob.com/content/5/1/22 Table 2: Antibiotic resistance profiles of 61 strains of MRSA isolated in an orthopaedic surgical ward Pattern Antibiotic resistance profiles of MRSA No of resistance markers Strains 10 ... isolates was lesser than clinical strains in case of all antibiotics In clinical (n = 338) and carrier (n = 175) isolates of S aureus the highest resistance was Table 4: Minimal inhibitory concentrations...
  • 15
  • 419
  • 0
Báo cáo sinh học: "Trends in antibiotic susceptibility patterns and epidemiology of MRSA isolates from several hospitals in Riyadh, Saudi Arabia" doc

Báo cáo sinh học: "Trends in antibiotic susceptibility patterns and epidemiology of MRSA isolates from several hospitals in Riyadh, Saudi Arabia" doc

Ngày tải lên : 08/08/2014, 19:20
... Coleman BT, Osaba AO, Thagafi AO, Lamfon MA: MRSA prevalence in a teaching hospital in Western Saudi Arabia Saudi Med J 2003, 24:1313-1316 Al-Haj-Hussein BT, Al-Shehri MA, Azhar EA, Ashankyty ... homogeneity among methicillin-resistant Staphylococcus aureus strains from Saudi Arabia Microbial Drug Resistance 1997, 3(4):365-369 Madani TA, Al-Abdullah NA, Al-Sanousi AA, Ghabrah TM, Afandi SZ, Bajunid ... highly active against Gram-positive bacteria, including resistant strains Like quinupristin/dalfopristin, linezolid is active against MRSA, but is only bacteriostatic Linezolid is available in both...
  • 11
  • 384
  • 0
Báo cáo sinh học: "The molecular epidemiology of Stenotrophomonas maltophilia bacteraemia in a tertiary referral hospital in the United Arab Emirates 2000–2004" pot

Báo cáo sinh học: "The molecular epidemiology of Stenotrophomonas maltophilia bacteraemia in a tertiary referral hospital in the United Arab Emirates 2000–2004" pot

Ngày tải lên : 08/08/2014, 19:20
... Recovered NA NA NA NA NA NA No* NA No* NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA = Not applicable; ALL = Acute lymphoblastic leukaemia; AML = Acute myeloid leukaemia; NHL = Non-Hodgkins Lymphoma ... Stage Renal Failure AML ALL ALL NHL Line Line Line Line Line Line Line Cellulitis Pneumonia Line Line Febrile neutropenia Line-related abscess Line Line Line Line Line Line Line Line Line Line ... spread We report the clinical characteristics of bacteraemia in Tawam Hospital, UAE and investigate the molecular epidemiology of S maltophilia bacteraemia isolates from the hospital aiming to...
  • 6
  • 347
  • 0
Báo cáo y học: " Descriptive epidemiology of stigma against depression in a general population sample in Alberta" doc

Báo cáo y học: " Descriptive epidemiology of stigma against depression in a general population sample in Alberta" doc

Ngày tải lên : 11/08/2014, 16:22
... hold stigmatizing attitudes than women [15,21] A higher level of education and being a health professional were negatively associated with depression stigma In the Australian and the Canadian studies ... cross-sectional study examining depression literacy and stigma in Alberta, Canada The target population was household residents in Alberta, aged 18 - 74 years old Participants were recruited using random ... difference at all in dealing with depression [29] As a result, future research into mental health stigma should continue in order to gain insight into mental health literacy and search for potential influences...
  • 11
  • 328
  • 0
báo cáo khoa học: " The epidemiology of college alcohol and gambling policies" pot

báo cáo khoa học: " The epidemiology of college alcohol and gambling policies" pot

Ngày tải lên : 11/08/2014, 20:20
... strategies Policy, Binge Drinking and Gambling The analysis of policy variables and binge drinking rates revealed a variety of relationships among policy variables and student drinking behaviors ... policy variables and the presence of gambling policy on binge drinking behavior and past-year student gambling behavior presents an interesting and unanticipated finding Because schools that have ... gambling as possible; therefore we set a liberal alpha level (α = 1) for this analysis A one-way analysis of variance (ANOVA) revealed that four of the 22 policy variables had significant relationships...
  • 20
  • 420
  • 0
Báo cáo y học: "Molecular epidemiology of hepatitis E virus infections in Shanghai, China" ppt

Báo cáo y học: "Molecular epidemiology of hepatitis E virus infections in Shanghai, China" ppt

Ngày tải lên : 11/08/2014, 21:22
... Veterinary Medicine, Shanghai Academy of Agricultural Sciences, Shanghai 201106, China Aff2 Shanghai Key Laboratory of Agricultural Genetics and Breeding, Shanghai 201106, China Aff3 Nanjing Agricultural ... Nishizawa T, Sato H, Sato Y, Jirintai, Nagashima S, Okamoto H: Analysis of the full-length genome of a hepatitis E virus isolate obtained from a wild boar in Japan that is classifiable into a novel ... Sato H, Naka K, Furuya S, Tsukiji H, Kitagawa K, Sonoda Y, Usui T, Sakamoto H, Yoshino S, Shimizu Y, Takahashi M, Nagashima S, Jirintai, Nishizawa T, Okamoto H: A nationwide survey of hepatitis...
  • 10
  • 364
  • 0
Báo cáo y học: " Molecular epidemiology of Japanese encephalitis virus circulating in South Korea, 1983-2005" doc

Báo cáo y học: " Molecular epidemiology of Japanese encephalitis virus circulating in South Korea, 1983-2005" doc

Ngày tải lên : 12/08/2014, 04:20
... http://www.virologyj.com/content/7/1/127 Page of Table 2: Details of 29 JEV strains compared with Korean strains Strain Year Location Source Genotype Accession no Fu 1995 Australia Human serum AF217620 P3 1949 China Human brain AY243844 ... Indonesia Mosquito U70408 JKT9092 1981 Indonesia Mosquito U70409 Nakayama 1935 Japan Human brain U70413 JaOH0566 1966 Japan Human brain AY029207 JaOArS1186 1986 Japan Mosquito AB028262 JaOArK5990 ... in China in 1979 [13], in Vietnam in 2001 [9], and in Thailand in 1991 [14] Although several explanations have been offered [5,7,9], we believe that migrating water birds may be a major mediator...
  • 7
  • 356
  • 0

Xem thêm