tips for writing a letter of recommendation for a friend
Báo cáo khoa học: "Implementing a Characterization of Genre for Automatic Genre Identification of Web Pages" pot
Ngày tải lên :
23/03/2014, 18:20
... more dynamic view of a genre classification
system.
Automatic identification of text types and
genres represents a great advantage in many
fields because manual annotation is expensive
and time-consuming. ... blog_augustine_0000024
704
of being argumentative_persuasive shows a high
gradation of argumentation. Gradations/
probabilities are ranked for each web page.
The computation of text types as ... ca. 86%.
An accuracy of 86% is a good achievement for
a first implementation, especially if we consider
that the standard Naïve Bayes classifier returns
an accuracy of about 67%. Although slightly...
- 8
- 318
- 0
Example Questions for Writing Task II of IELTS
Ngày tải lên :
04/10/2012, 10:24
... doing trials on innocent animals. Give your opinion in not
to-face contact for its main means of communication?
34.Zoos are sometimes seen as necessary but not poor alternatives to a natural environment. ... efficiency decreases. Should young people in the
working fields replace all the old people?
22. Animals also have emotions and feel equal pain as humans. We should stop all
pharmaceutical companies from ... few changes in not less than 250 words.
7.Computers can easily do all the basic and advanced calculations. Do you think your
children should spend more time learning basic mathematics or advanced...
- 4
- 1.5K
- 4
Tài liệu Security Agreement and Pledge For Use with Letter of Credit pptx
Ngày tải lên :
20/12/2013, 17:15
... that his application is subject to final credit approval and that additional
information may be required. By signing below the Applicant agrees that the Bank may place a hold on the
Collateral ... XY-ZU-4715
Page 2 of 2
FOR CORPORATIONS ONLY: THE PRESIDENT OR CHAIRMAN OF THE BOARD OR ANY VICE PRESIDENT AND ONE
OF THE FOLLOWING, SECRETARY, ASSISTANT SECRETARY, CHIEF FINANCIAL OFFICER OR ASSISTANT ...
Franchise Tax Board, at any time, and disclose information given Bank to the Applicant. All owners / authorized
signers must sign and include their titles.
The Applicant understands and agrees...
- 2
- 663
- 1
A novel interval method for validating state enclosures of the
Ngày tải lên :
12/01/2014, 22:04
... parameters is
1
Further information about ValEncIA-IVP as well as free software are available at http://www.valencia-ivp.com.
6
of the error bounds
R
(κ+1)
(t)
. Note that neither separate ... optimal, and adaptive controllers. For nonlinear systems, robustness analysis with respect
to uncertain initial states and parameters can be performed by calculating enclosures of all reachable
states. ... RESEARCH
In this paper, VALENCIA-IVP has been introduced as a novel approach for validation of state enclosures
for initial value problems with both uncertain initial conditions and tolerances...
- 12
- 373
- 0
Tài liệu A History of England for Boys and Girls pdf
Ngày tải lên :
20/02/2014, 08:20
... horror of war had filled the land for so many
CHAPTER 19 47
was really to blame for it. So Aurelius Ambrosius and Uther Pendragon fled away to that part of France called
Brittany, where they remained ... equal."
Then Arthur was sad no longer. He did as Merlin advised, and had a great round table made, at which there
was a seat for each one of his knights. After that there was no more quarreling ... last, weary of fighting, and forsaken by nearly
all his followers, Alfred was forced to hide for a time in the marshes of Somerset.
This was the saddest part of Alfred's life. He was a king,...
- 285
- 627
- 0
Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf
Ngày tải lên :
20/02/2014, 09:20
... the data and in further projects of similar
nature. For example, the ROUGE similarity could
be used in the data collection phase as a tool of au-
tomatic approval and rejection of workers’ assign-
ments.
4 ... several passages of
texts has for a long time been a research prob-
lem within the field of automatic summarisation.
For each document it is possible to create several
summarisations that can each be ... minimum of $0.05) service
fee per each paid reward.
ã Qualications To improve the data quality,
a HIT can also be attached to certain tests,
“qualifications” that are either system-provided
or created...
- 9
- 610
- 1
Tài liệu Báo cáo khoa học: "ModelTalker Voice Recorder – An Interface System for Recording a Corpus of Speech for Synthesis" ppt
Ngày tải lên :
20/02/2014, 09:20
... pitch, amplitude and pronuncia-
tion and users are given immediate feedback
on the acceptability of each recording. Users
can then rerecord an unacceptable utterance.
Recordings are automatically ... feedback on the
quality of each utterance they record in terms of
pronunciation accuracy, relative uniformity of
pitch, and relative uniformity of amplitude. Confe-
rence attendees will be able ... by a profes-
sional speaker and manually polished, all other
voices were created by untrained individuals, most
of whom have ALS, in an untrained setting, with
the recordings having no manual...
- 4
- 419
- 0
Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf
Ngày tải lên :
07/03/2014, 15:20
... Edmonton, AB, Canada
Type IIa bacteriocins, which are isolated from lactic acid
bacteria that are useful for food preservation, are potent
antimicrobial peptides with considerable potential as
therapeutic ... Engineering
Research Council of Canada, the Alberta Heritage Foundation for
Medical Research, CanBiocin Ltd (Edmonton, AB), and the Canada
Research Chair in Bioorganic and Medicinal Chemistry.
References
1. ... University of
Alberta) for performing all CD experiments. Albin Otter (Department
of Chemistry) and Ryan T. McKay (NANUC, University of Alberta)
are gratefully acknowledged for assistance with...
- 9
- 519
- 0
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx
Ngày tải lên :
07/03/2014, 21:20
... PCR was performed on an egfp-containing plasmid
(a gift from Dr K. Apt, Martek Biosciences, Columbia,
MD, USA) with sense primer SOE-3 (5Â-AAAAATCA
ACGCTGAACAATGGTGAGCAAAGGGCGAG-3Â) and
antisense ... (Invitrogen, Carlsbad, CA, USA)
by PCR using sense primer 5Â-ATCAAAACAACCAAAA
TGGCCAAGTTGACCAGTGC-3Â and antisense primer
5Â-GAAT
GCGGCCGCTCAGTCCTGCTC CTCGGCCAC-3 ¢,
which introduced a NotI restriction ... PCR was performed using Pnr BamHI5.4kb as the
template with sense primer 5Â-GAAT
GCGGCCGCGA
ATGTGTGCAAATTGAAGAAC-3Â and antisense primer
5Â-TTCGAGCTCCGGGGAAACGGTGCCAACTT-3Â,which
introduced a NotI...
- 11
- 668
- 0
Báo cáo khoa học: "A Word-Order Database for Testing Computational Models of Language Acquisition" docx
Ngày tải lên :
08/03/2014, 04:22
... All grammar
settings and annotations are saved and available
the next time the user logs on. Finally on the Data
Download page, users may download data so that
they can use the patterns and ... Selection and Data
Download. First a user has to specify, on the
Grammar Selection page, which settings of the 13
parameters are of interest and save those settings as
an available grammar. A user ... with all possible
syntactic derivations of each pattern. The patterns
and their derivations are generated from a large
battery of grammars that incorporate many features
from the domain of natural...
- 8
- 368
- 0
Center for Audit Quality Observations on the Evolving Role of the Auditor: A Summary of Stakeholder Discussions doc
Ngày tải lên :
15/03/2014, 20:20
... Financial Of cer, Bank of Marin
Alison Davis, Chairman, LECG and Member, Board of Directors, City National Bank
Paul Dawes, Retired Partner, Latham & Watkins LLP
CENTER FOR AUDIT QUALITY ... ROLE OF THE AUDITORA SUMMARY OF STAKEHOLDER DISCUSSIONS
9
(2) For each area:
ã Whatlevelofassuranceshouldbeprovidedandwhat is the appropriateformofauditor
communication?
ã Wouldauditorassociationrequiresignicantadditionalprocedures(separatefromdraftingthe
auditors ... regulations and interpretive guidance for MD& ;A disclosure
(attorneys and former regulators).
t
Management is not taking advantage of the safe harbor afforded by SEC regulations for forward-looking...
- 20
- 388
- 0
The Future of the Internet: A Compendium of European Projects on ICT Research Supported by the EU 7th Framework Programme for RTD ppt
Ngày tải lên :
15/03/2014, 21:20
... package takes care
of the overall management of the project’s operational and
nancial aspects and facilitates in- and external cooperation.
WP2: Use cases and framework for self-organisation. ... Global standards for a new generation of ubiquitous and
extremely high capacity network and service infrastructures
(…):
o E harmonisation of legacy and new standards for e cient,
advanced and ... both a database infrastructure
and a tool for real-time measurements.
ã LOBSTER: LOBSTER provides a database infrastructure.
ã RIPE: RIPE provides a database infrastructure.
ã BART: BART is a...
- 162
- 453
- 0
Báo cáo khoa học: "A Figure of Merit for the Evaluation of Web-Corpus Randomness" ppt
Ngày tải lên :
17/03/2014, 22:20
... lan-
guage, excluding function words, while Ueyama
and Baroni (2005) built corpora of Japanese using
seed words from a basic Japanese vocabulary list.
Both Sharoff and Ueyama and Baroni evaluated
the ... through a manual classification of the
retrieved pages and by qualitative analysis of the
words that are most typical of the Web corpora.
We are also interested in evaluating the effect
that different ... construct a “balanced” corpus via a search
engine one reasonable strategy is to use appro-
priately balanced query terms, e.g., using ran-
dom terms extracted from an available balanced
corpus (Sharoff,...
- 8
- 436
- 0
A MANUAL OF PRONUNCIATION FOR PRACTICAL USE IN SCHOOLS AND FAMILIES CONTAINING A CAREFUL SELECTION pdf
Ngày tải lên :
22/03/2014, 16:22
... This may be illustrated by such
words
as abdomen, acclimate,appendicitis, candelabrum, data, finance, ignoramus, gratis,
etc.
There are many words in our language about whose pronunciation ... the English language is the usage that
prevails among the best-educated portion of the people to whom the language is
vernacular; or, at least, the usage that will be most generally approved by ...
Campbell's law of the good usage of a word applies with much force to its
pronunciation. This law requires this usage to be, first, reputable, or the practice of
intelligent and educated...
- 156
- 470
- 0
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2