thus magma can be generated by raising a rock apos s temperature as occurs when a hot mantle plume quot ponds quot beneath crustal rocks

Strategic environmental assessments may be used to compare different energy scenarios, and a more sustainable power plan can be developed by incorporating the wider impacts considered during the assessment process

Strategic environmental assessments may be used to compare different energy scenarios, and a more sustainable power plan can be developed by incorporating the wider impacts considered during the assessment process

Ngày tải lên : 08/09/2015, 23:32
... methods for developing qualitative comparisons between all of the indicators and security aspects using a radar diagram approach illustrates how the assessment can highlight the strengths and weaknesses ... methods for developing qualitative comparisons between all of the indicators and security aspects using a “radar diagram” approach illustrates how the assessment can highlight the strengths and weaknesses ... energy capacity is assumed to be located in areas of high resource potential, as follows:9 (i) solar potential is concentrated in central and northeast Thailand and along Viet Nam s coastline;...
  • 50
  • 456
  • 0
PERFECT PRESENTATIONS Presenting with impact is a skill that can be learned by anyone

PERFECT PRESENTATIONS Presenting with impact is a skill that can be learned by anyone

Ngày tải lên : 27/06/2016, 10:30
... Speaking • Many dread it • Basic skills can be learned to get message across • With application and good training anyone can be a fluent and confident speaker • A great asset you will use throughout ... Presenters present, not the laptop • Is about the message you want to convey Presentation • Like a glass containing good whisky • The glass contain the whisky so that people can appreciate and savour ... Introduction Managers • A vast majority not have innate presentation skills • Can learn to present ideas effectively • Being a good public speaker build your selfconfidence Clear Message Public Speaking...
  • 23
  • 393
  • 0
Báo cáo khoa học: The propagation of hamster-adapted scrapie PrPSc can be enhanced by reduced pyridine nucleotide in vitro pdf

Báo cáo khoa học: The propagation of hamster-adapted scrapie PrPSc can be enhanced by reduced pyridine nucleotide in vitro pdf

Ngày tải lên : 07/03/2014, 03:20
... Sci USA 95, 13363–13383 Collinge J (2001) Prion diseases of humans and animals: their causes and molecular basis Annu Rev Neurosci 24, 519–550 Sparrer HE, Santoso A, Szoka FC Jr & Weissman JS (2000) ... PrPSc maintains a stable propagating capacity in normal brain homogenates after NADPH is removed Because the increased level of NADPH-diaphorase may correlate with the active synthesis of NADPH, ... increased the sensitivity for detection of PrPSc in brain homogenates by PMCA To test the potential of using NADPH as an assistant chemical in increasing the detection sensitivity of PMCA, comparative...
  • 10
  • 342
  • 0
Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt

Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt

Ngày tải lên : 23/03/2014, 04:20
... were used: Y28 6A, 5¢-GATCA TGAATTGTTTCTGTCGCCAGTAACCAGCTTGGCCC CAGGAGGAGACATAGGCG-3¢; LSYTRF, 5¢-GCAAG AAGAATTGTTTCTGTCGCCAGTGAACCGGGTATAT GACAAAGGAGACATAGGCGAGAGGGGAGC-3¢ The complementary sequences ... presence of another basolateral sorting determinant located in the second transmembrane domain of Cx43 Although not as common as cytoplasmic sorting signals, transmembrane sorting signals have been ... For example, the gastric H,K-ATPase has an apical sorting signal in its 4th transmembrane domain, although the exact amino acids responsible have not been identified [50] Studies have shown that...
  • 14
  • 433
  • 0
Báo cáo y học: "Radiographic joint damage in rheumatoid arthritis is associated with differences in cartilage turnover and can be predicted by serum biomarkers: an evaluation from 1 to 4 years after diagnosis" pot

Báo cáo y học: "Radiographic joint damage in rheumatoid arthritis is associated with differences in cartilage turnover and can be predicted by serum biomarkers: an evaluation from 1 to 4 years after diagnosis" pot

Ngày tải lên : 09/08/2014, 07:20
... products enter body fluids as 'biomarkers', where they can now be detected by sensitive immunoassays in accessible fluids such as serum and urine [5-9] These biomarker assays may be of use in distinguishing ... [4] Radiographs only reveal gross anatomical changes It usually takes at least one year before significant changes in joint damage can be observed This delay means there is a need for more sensitive ... present study, whereas a radioimmunoassay format was used in previous studies [13,14] Another ELISA assay was used to measure the synthesis of type II procollagen by detection of the carboxy propeptide...
  • 9
  • 525
  • 0
Báo cáo y học: "Granulocyte-CSF induced inflammation-associated cardiac thrombosis in iron loading mouse heart and can be attenuated by statin therapy" pptx

Báo cáo y học: "Granulocyte-CSF induced inflammation-associated cardiac thrombosis in iron loading mouse heart and can be attenuated by statin therapy" pptx

Ngày tải lên : 10/08/2014, 05:21
... Windows (version 12.0) All data are described as means ± standard deviation (S. D.) The two groups were compared using the Student s t-test Statistical analysis was performed with one-way ANOVA by Tukey ... loading can increase cardiac oxidative stress Whereas G-CSF treatment activates serial events of inflammation-thrombosis circuitry and that leads to intra-cardiac thrombus formation This inflammationassociated ... G-CSF-induced thrombosis can only be ameliorated by simvastatin therapy, but not by tirofiban treatment, implying a significant role of inflammation association in our model Simvastatin also ameliorates...
  • 15
  • 342
  • 0
Báo cáo y học: "Chylopericardium after cardiac surgery can be treated successfully by oral dietary manipulation: a case report" docx

Báo cáo y học: "Chylopericardium after cardiac surgery can be treated successfully by oral dietary manipulation: a case report" docx

Ngày tải lên : 10/08/2014, 10:20
... Cardiovasc Surg 1996, 112:1120-1 Sakata S, Yoshida I, Otani Y, Ishikawa S, Morishita Y: Thoracoscopic treatment of primary pericardium Ann Thorac Surg 2000, 69:1581-2 Hashim SA, Roholt HB, Babayan ... showing patients enlarged mediastinal shadowing from chylopericardium lycerides/fat free diet The second day after pericardiocentesis was performed, the drainage was still substantial at 1.5 litres ... apyrexial after seven days By day 20 post readmission, the drainage had tailed off to less than 20 ml per day The patient was subsequently commenced on a normal diet The drain output was observed...
  • 3
  • 426
  • 0
Thuyết trình tài chính quốc tế CAN CENTRAL BANKS’ MONETARY POLICY BE DESCRIBED BY A LINEAR (AUGMENTED) TAYLOR RULE OR BY A NONLINEAR RULE

Thuyết trình tài chính quốc tế CAN CENTRAL BANKS’ MONETARY POLICY BE DESCRIBED BY A LINEAR (AUGMENTED) TAYLOR RULE OR BY A NONLINEAR RULE

Ngày tải lên : 21/06/2015, 23:44
... s ch tiền tệ Fourcans Vranceanu (2004) đ a s chứng cho thấy ECB có phản ứng tỷ giá hối đoái lệch so với mức trung bình Chadha cộng (2004) đ a kết tương tự cho FED, NHTW Anh NHTW Nhật Lubik Schorfheide ... G(η,c,st) hàm biến chuyển tiếp st giả định liên tục bị chặn Khi st → -∞, G(η,c,st) → st → +∞, G(η,c,st) → η tham s độ dốc c tham s vị trí (tham s ngưỡng) PHẦN PHẦN PHẦN PHẦN PHẦN Tuyến tính so ... EFCI bao gồm có tỷ trọng bình qn tỷ giá hối đối thực, giá cổ phần thực giá tài s n thực cộng với credit spead futures interest rate spead Biến credit spread xem báo tốt cho chu kỳ kinh doanh căng...
  • 63
  • 928
  • 13
Thuyết trình tài chính quốc tế Can central bank’s monetary policy be described by a linear (augmented) Taylor rule or by a monetary  rule

Thuyết trình tài chính quốc tế Can central bank’s monetary policy be described by a linear (augmented) Taylor rule or by a monetary rule

Ngày tải lên : 14/07/2015, 08:34
... past or current values of these variables  Fourc¸ ans and Vranceanu (2004) and Sauer and Sturm (2007) also stress the importance of considering a forward-looking Taylor rule in the analysis ... Eurozone Most variables have also proved to be stationary for the UK and US • Despite the estimates for OutpGap and π* being reasonable, results indicate that this simple model is unable to capture ... with assuming that the central bank does not adjust the interest rate immediately to its desired level but is concerned about interest rate smoothing  Including asset prices and financial variables...
  • 59
  • 1.1K
  • 0
Thuyết trình Can central banks’ monetary policy be described by a linear (augmented) Taylor

Thuyết trình Can central banks’ monetary policy be described by a linear (augmented) Taylor

Ngày tải lên : 14/07/2015, 08:34
... each asset, but this study intends to show that they can extract some additional information from the evolution of those assets, as well as from other financial variables, when setting interest ... real-time data for the Eurozone instead of ex-post data does not lead to substantially different results As the quality of predictions for output and inflation has increased in the last years, ... noises with variance-covariance matrices given by Var(µt) = Q and Var(ωt) = R, and with Var(µt s) = 0, for all t and s X is the matrix of the explanatory variables plus a constant; all variables...
  • 90
  • 626
  • 1
Tiểu luận tài chính quốc tế Can central banks’ monetary policy be described by a linear (augmented) Taylor rule or by a nonlinear rule

Tiểu luận tài chính quốc tế Can central banks’ monetary policy be described by a linear (augmented) Taylor rule or by a nonlinear rule

Ngày tải lên : 14/07/2015, 08:37
... ngh a thay đổi (khơng quan s t được) hệ s b ijt ước lượng cách s dụng lọc Kalman thông qua công thức (9) dạng state-space: Trong đó, sai s xem nhiễu trắng độc lập với ma trận phương sai – ... động s giá tiêu dùng, s s ch tiền tệ ECB - Lãi suất FedRate (Federal Reserve funds rate) hiệu s dụng dể ước lượng nguyên tắc Taylor US “Federal funds rate tỉ lệ lãi suất ngân hàng cho vay khoảng ... nonlinear central bank preferences (Dolado et al., 2000; Nobay and Peel, 2003; Ruge-Murcia, 2003 and Surico, 200 7a) or both (Surico, 2007b) Đặc biệt, Surico (2007b) nghiên cứu diện phi tuyến s ch...
  • 26
  • 500
  • 1
P4 can central banks’ monetary policy be described by a linear (augmented) taylor

P4 can central banks’ monetary policy be described by a linear (augmented) taylor

Ngày tải lên : 24/04/2018, 08:56
... those assets, as well as from other financial variables, when setting interest rates Finally, as the economic relevance of these variables changes over time, we are also allowing for the possibility ... Whether this variable has been indeed targeted by the ECB is not entirely clear and has been a matter of huge discussion to which this analysis tries to contribute.11 Financial variables and asset prices ... G(Á,c,st ) is assumed to be continuous and bounded between zero and one in the transition variable st As st → −∞, G(Á,c,st ) → and as st → +∞, G(Á,c,st ) → The transition variable, st , can be an...
  • 19
  • 139
  • 0
TOWARDS A CARIBBEAN CINEMA - CAN THERE BE OR IS THERE A CARIBBEAN CINEMA? ppt

TOWARDS A CARIBBEAN CINEMA - CAN THERE BE OR IS THERE A CARIBBEAN CINEMA? ppt

Ngày tải lên : 07/03/2014, 15:20
... the mango season The mango season in the Caribbean is as much a season as the four seasons of North American and can be used as transitions in film Mango season, when mangoes of varied colors and ... been assumed to be a person of African descent On the contrary, the Caribbean is made up of Africans, East Indians, Asians, White Europeans and descendants of Native Americans (the Caribs and Arawaks) ... Associate Professor of Film Studies Raymond Tymas-Jones Dean, College of Fine Arts SAMPSON, DESIREE M .A August 2004 Film Studies Towards a Caribbean Cinema - Can there be or is there a Caribbean...
  • 89
  • 557
  • 0
Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel fluorescent probe pdf

Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel fluorescent probe pdf

Ngày tải lên : 16/03/2014, 11:20
... images were analyzed using image-pro plus 4.5 software Materials o-Aminobenzenothiol was purchased from Fluka (Shanghai, China) A stock solution (1 mm) of DBZTC (synthesized in-house) was prepared ... double-distilled water, the mixture was equilibrated and was laid aside at 37 °C for 10 before determination The fluorescence intensity was measured at kex ⁄ em ¼ 485 ⁄ 559 nm against a reagent blank at ... investigations of the generation, metabolism, and mechanisms of superoxide-mediated cellular homeostasis and injury pH meter (Shanghai Lei Ci Device Works, Shanghai, China) with a combined glass–calomel...
  • 9
  • 401
  • 0
Báo cáo khoa học: "From Extractive to Abstractive Meeting Summaries: Can It Be Done by Sentence Compression?" pdf

Báo cáo khoa học: "From Extractive to Abstractive Meeting Summaries: Can It Be Done by Sentence Compression?" pdf

Ngày tải lên : 23/03/2014, 17:20
... evaluation process For each extractive summary sentence, we asked 10 human subjects to rate the compressed sentences from the three systems, as well as the human compression This evaluation was ... to generate abstractive summaries, we compare the compressed summaries, as well as the original extractive summaries, against the reference abstractive summaries The ROUGE-1 results along with ... grammaticality of the compressed sentences Finally, as a comparison, we also use human compression All of these compressed sentences are compared to abstractive summaries Our experiments using the ICSI...
  • 4
  • 342
  • 0
Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot

Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot

Ngày tải lên : 18/06/2014, 16:20
... cells), and thus serves as an internal control All other sets are proper subsets of the universal set As presented here, Exhaustive Expansion applies to binary classification systems (e.g positive ... Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients ... functional assays, are needed to validate the hypotheses generated by this work Second, from an assay perspective, the analytical approach described here more readily supports those circumstances where...
  • 15
  • 476
  • 0
báo cáo hóa học:" Finger joint motion generated by individual extrinsic muscles: A cadaveric study" doc

báo cáo hóa học:" Finger joint motion generated by individual extrinsic muscles: A cadaveric study" doc

Ngày tải lên : 20/06/2014, 01:20
... impedance could be a possible reason for this observation The passive joint characteristics such as the number of muscles crossing the joint could govern its impedance The MCP joint has more muscles ... their maximum force potentials This loading force was judged reasonable because phalangeal motion requires sub-maximal activation of the muscles, and the purpose of this study was to examine the ... biomechanical modeling investigations Landsmeer presented a detailed discussion, based on his anatomical investigations, elaborating various scenarios of coordinated motion of the polyarticular finger...
  • 7
  • 194
  • 0
Báo cáo toán học: "Permutations generated by a stack of depth 2 and an infinite stack in series" potx

Báo cáo toán học: "Permutations generated by a stack of depth 2 and an infinite stack in series" potx

Ngày tải lên : 07/08/2014, 13:21
... for the set For example, the set of permutations that avoid 12 and 123 is the set of all decreasing permutations, and its basis is simply {12} Note also that if σ is in a basis for a set S then ... 1998 [6] Steve Linton GAP program to study classes of permutations generated by token passing networks via finite state automata, http://www-groups.dcs.st-and.ac.uk/~sal [7] Max Murphy Restricted ... followed by an infinite stack, and define Bk,∞ as its basis So for example, the basis for a stack of depth one (so no storage) followed by an infinite stack is {312} We will call the input symbols letters...
  • 12
  • 241
  • 0
Báo cáo lâm nghiệp: "Infrared images of heat fields around a linear heater in tree trunks: what can be learned about sap flow measuremen" pptx

Báo cáo lâm nghiệp: "Infrared images of heat fields around a linear heater in tree trunks: what can be learned about sap flow measuremen" pptx

Ngày tải lên : 07/08/2014, 16:20
... Ws mol−1 has been defined as the negative ratio of heat transport via sap transport JT S to the sap flux JS It can be assumed that the heat flux at the heat probe is increasing proportional to the ... as well as a temperature sensor array along the axis Infrared images of heat field and sap flow 659 Since p and z are measured distances, a can be calculated numerically from (15) and inserted into ... understand how to evaluate infrared heat field patterns for a better planning and handling of sap flow measurements based on a minimum of sensors, some physical and mathematical considerations are...
  • 8
  • 377
  • 0