three proton pumps and a physical link to the citric acid cycle
Báo cáo toán học: " An introduction to 2-fuzzy n-normed linear spaces and a new perspective to the Mazur-Ulam problem" docx
... Misiak [3], a Kim and Cho [4], and Malˇeski [5] developed the theory of n-normed c space In [6], Gunawan and Mashadi gave a simple way to derive an (n−1)-norm from the n-norms and realized that any ... An introduction to 2-fuzzy n-normed linear spaces and a new perspective to the Mazur–Ulam problem Choonkil Park1 and Cihangir Alaca∗2 Department of Mathematics, Research Institute for Natural ... Bag and Samanta [8] and also gave some fundamental properties of this space In 1932, Mazur and Ulam [11] proved the following theorem Mazur–Ulam Theorem Every isometry of a real normed linear...
- 39
- 371
- 0
Tài liệu Báo cáo Y học: Evolution of the enzymes of the citric acid cycle and the glyoxylate cycle of higher plants pdf
... a- proteobacteria and cyanobacteria because they are thought to be the progenitors of mitochondria and plastids, respectively However, the spectrum of a- proteobacteria and cyanobacteria available ... related to eubacterial than to archaebacterial homologues, and appears to be a eubacterial acquisition Isocitrate dehydrogenase (ICDH) Isocitrate NAD ! a- oxoglutarate NADH Isocitrate NADP ... 137±141 76 Watanabe, S., Takada, Y & Fukunaga, N (2001) Puri®cation and characterization of a cold±adapted isocitrate lyase and a malate synthase from Colwellia maris, a psychrophilic bacterium...
- 16
- 474
- 0
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc
... without reappearance of any new signals was the result of Cu(I) to polypeptide stoichiometries higher than five Taken together, the initial additions of Cu(I) to each domain caused the disappearance ... domain adapts to host the additional copper(I) ions by opening up and rearranging its N- and C-terminal parts, minimizing the structural perturbation of its central part The arrangement of the ... kPa For the a- domain, an average molecular mass of 3021.3 Da (3021.7 Da, theoretical) was observed, calculated from the detected [M + 5H]5+ and [M + 4H]4+ quasi molecular ions at m ⁄ z 605.2 and...
- 14
- 485
- 0
An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel
... approaches the learner as a user of language rather than as a learner of language 1.2.3.3 A learning centered approach According to Hutchinson and Water (1987:72), “we would reject the term a ... the teachers of the objective they have to reach at the end of each unit and to encourage teachers to find suitable teaching methods Objectives, at the same time, enable teachers to arrange appropriate ... learners' needs, but also to the constraint of the educational institution or system, and the length and scope of program based on the syllabus Goals can the analyzed according to their orientation...
- 43
- 591
- 1
Tài liệu The Contribution of Sexual and Reproductive Health Services to the Fight against HIV/AIDS: A Review pptx
... of the cervix, vagina, anal and genital area, and a higher incidence of cervical intraepithelial neoplasia (CIN) and advanced cervical disease, and at younger ages, than women in the general ... preventing and managing HIV infection through the use of family planning and dual protection, safe antenatal and delivery care, and STI prevention and treatment Antenatal care, child health care and ... during antenatal care is now available in many countries, and since treatment for PMTCT became feasible and affordable, there appears to be increasing demand, especially in sub-Saharan Africa.75...
- 23
- 719
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of SDS ⁄ PAGE ... omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards...
- 11
- 731
- 0
Báo cáo Y học: The unorthodox histidine kinases BvgS and EvgS are responsive to the oxidation status of a quinone electron carrier ppt
... nonradioactive ATP were added After the addition of Q-0 and/ or ATP samples were taken immediately and after 0.5, 1, 2, 4, 8, 16 and 32 min; the reaction was stopped by the addition of sample buffer The half-life ... example, it is known that high aeration and logarithmic growth of the bacteria leads to a predominance of Q-8, whereas under anaerobic conditions and in stationary phase MK-8 is the predominant ... note that the PAS domain of the phosphorelay histidine kinase A of Bacillus subtilis was recently shown to be a catalytic ATP-binding domain [31] As the PAS domain of BvgS contains a putative ATP...
- 6
- 421
- 0
Testing Costs and Testing Capacity According to the REACH Requirements – Results of a Survey of Independent and Corporate GLP Laboratories in the EU and Switzerland potx
... bound and compared to our capacity figures very low We have summarized the average and maximum testing capacity in appendix The ratio of the maximum capacity to the average capacity available is about ... incorporates all the relevant data However, there is no general standard for an acceptable level of price variability Thus, we had to fix a reasonable boundary The ratio mean to median of a sample ... provide analytical backup for all these studies at the same speed as the in vivo part of the study and their capacity to this currently would depend on the availability of the methods and the ease...
- 19
- 493
- 1
LUẬN VĂN " A THESIS SUBMITTED TO THE GRADUATE SCHOOL OF NATURAL AND APPLIED SCIENCES OF MIDDLE EAST TECHNICAL UNIVERSITY " pot
... glass formation and the amount of the atomic size mismatch in binary alloys by the following equation: C = (R B / R A ) −1 (2.5) where RA and RB are radii of the solvent atom A and solute atom ... state and finally to the crystalline state when moderately heated Physical, chemical, and mechanical properties of the metallic glasses are significantly affected by the structural changes that ... deviation of that fluid from an Arrhenius behaviour and takes values between and 100 [40] The liquids with a fragility parameter smaller than 10 are classified as “fragile” According to the available...
- 140
- 552
- 0
Báo cáo khoa học: "A concurrent approach to the automatic extraction of subsegmental primes and phonological constituents from speech" docx
... both the initial fricative and the final plosive at Stage Again, it may be possible to identify a unique word candidate at the end of Stage 2, but if several candidates are available, recognition ... defining a quadratic discriminant based on the variance-covariance Figure Stagewise cue invocation strategy This launches the calculation of cues 4)5 (for the automatic segmentation process) and 4)6 ... and standard code for FFT as in a spectrogram display object Users may add words using a keypad labelled with IPA symbols Manner class sequences and constituent structure are generated automatically...
- 5
- 337
- 0
WHAT IS BETA GLUCAN? A Concise Guide to the Benefits and Uses of the Most Powerful Natural Im- mune Enhancer Known to Science ppt
... bound to radioactive dye and the course of action was following after oral administration to mice The macrophages took up the glucans, and then transported them to the spleen, lymph glands, and ... this to the usual oatmeal for breakfast and barley soup Steamed barley can be eaten instead of brown rice Oat flour can be added to bread Various hot and cold breakfast cereals contain barley and ... oral and parenteral administration of oat beta glucan and these enhanced responses may play an important role in providing resistance to bacterial and parasitic infection Current pharmacological...
- 51
- 527
- 3
reasons of identity a normative guide to the political and legal assessment of identity claims nov 2009
... Canada, Australia, New Zealand, and the United States have no history of organizing on the basis of a peasant identity, as they did in Latin America, or any identity other than one which emphasizes, ... strategically today largely because international organizations such as the United Nations, the International Labour Organization, and UNESCO, as well as human rights groups, The Identity Approach 29 and ... example, an individual’s right to use a language is practically useless unless others (and usually many others) share the language and can practice it together Similarly, some crucial religious practices...
- 197
- 386
- 0
canoe country wildlife a field guide to the north woods and boundary waters jul 1992
... Lake Saganaga, Knife Lake, Basswood, and Lac la Croix form the 100-mile international border between the Boundary Waters and Quetico—between the United States and Canada The Boundary Waters and ... back that this strange animal swam in the water all day and had scales on \te> tail So by papal decree the Beaver wae> officially declared a fish, and the voyageurs could eat It any day of the ... flaps, called patagia, are spread wide in flight, effectively tripling the gliding surface area to create a personal parachute Bats are the only other Northern American mammals to possess patagia 21...
- 240
- 537
- 0
– ANSWERS – Set 7 (Page 13) 102. c. A leopard, cougar, and lion all belong to the cat family; doc
... more than doze, and hibernate is more than sleep The other choices are not related in the same way 246 a A banquet and a feast are both large meals; a palace and a mansion are both large places ... is to photograph as teakettle is to a cup of tea The camera is used to make the photo; the teakettle is used to make the tea 214.b Hat and mittens are to desert as snorkel and flippers are to ... Not all hurricanes cause damage (choice c) 170 c Without a signature, there is no autograph Athletes and actors (choices a and b) may sign autographs, but they are not essential An autograph can...
- 23
- 431
- 0
Health and Quality of Life Outcomes BioMed Central Commentary Open Access A brief guide to the pdf
... present data demonstrating that their scale is sensitive to change in these circumstances, and the same data can be used for another purpose, to demonstrate effect size of a treatment A longitudinally ... of a scale Neither the scale nor the treatment can be characterised as showing a particular effect size (i.e., having a particular sensitivity to change), because each depends on other factors ... size and hence the apparent treatment efficacy will be affected also by the population and the scale Discussion The best way to select a QOL questionnaire is examine the items of the scale carefully,...
- 5
- 349
- 0
Báo cáo khoa học: "Genetic determination of vessel area in oak (Quercus robur L and Q petraea Liebl): a characteristic related to the occurrence of stem shakes" docx
... areas in ash (Doley and Leyton, 1968) The fact that IAA is also known to inhibit the emergence of buds in Q alba (Vogt and Cox, 1970) strongly suggests that leaf emergence and earlywood formation ... highly significant differences between early and late flushing trees (P > 0.0001) which accounted for almost 20% of all variation Means and standard errors for vessel areas for early and late flushing ... family i, on data may individual μ is the overall vessel area; g is the effect of genoi as random; ij e is the normally and independently distributed random deviation of genotype i, with a...
- 4
- 287
- 0
Báo cáo y học: "Adrenal suppression: A practical guide to the screening and management of this under-recognized complication of inhaled corticosteroid therapy" pptx
... is important to remember that effective antiinflammatory therapy is essential for the treatment of asthma, that ICSs are the most effective anti-inflammatory agents available, and that the suppressive ... desirable Several Table Pharmacodynamic (PD) and pharmacokinetic (PK) properties of the ICSs available for the management of asthma in Canada[53,54] ICS Beclomethasone dipropionate Oral bioavailability ... Ontario, Canada 4University of Calgary, Alberta Children’s Hospital, Calgary, Alberta, Canada Authors’ contributions AA contributed to the conception, drafting and writing of the manuscript and...
- 12
- 774
- 0
Báo cáo y học: "Glycogen synthase kinase 3, circadian rhythms, and bipolar disorder: a molecular link in the therapeutic action of lithium" docx
... Sato TK, Panda S, Miraglia LJ, Reyes TM, Rudic RD, McNamara P, Naik KA, FitzGerald GA, Kay SA, Hogenesch JB: A functional genomics strategy reveals Rora as a component of the mammalian circadian ... lines (A1 .4 and A1 .6), generated the c2.1 3/4 DKO mutant, and carried the clonal Western analysis and selection NA participated in the analysis of results and figure designs JW participated in the ... Hitomi K, Thresher RJ, Ishikawa T, Miyazaki J, Takahashi JS, Sancar A: Differential regulation of mammalian period genes and circadian rhythmicity by cryptochromes and Proc Natl Acad Sci USA...
- 12
- 377
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25