0

this research is sponsored by the us national science foundation under grant cts 0121058 the program managers are drs frederica darema c f chen and michael plesniak

Báo cáo y học:

Báo cáo y học: "LV reverse remodeling imparted by aortic valve replacement for severe aortic stenosis; is it durable? A cardiovascular MRI study sponsored by the American Heart Association" pot

Báo cáo khoa học

... critical discussions of the study results, critical analysis of the various drafts of the manuscript and review/approval of its’ final draft All authors read and approved the final manuscript Competing ... multivariate analysis as they were unable to account for the failure of LVH regression Should this be surprising to us? Are there inferences in the literature that might guide us to this conclusion? Several ... had concomitant CAD but were without significant differences in their peak and mean transvalvular gradient by either echocardiography or CMR There was no significant difference between the CMR...
  • 8
  • 332
  • 0
Tài liệu IAB Internet Advertising Revenue Report: An Industry Survey Conducted by PwC and Sponsored by the Interactive Advertising Bureau (IAB) doc

Tài liệu IAB Internet Advertising Revenue Report: An Industry Survey Conducted by PwC and Sponsored by the Interactive Advertising Bureau (IAB) doc

Quản trị mạng

... brokerage of securities and other financial contracts Telecommunications Includes point-to-point communications services, including telephone voice and data communications, two-way mobile/cellular communications ... (e.g., cable television, wireless cable television and direct broadcast satellite services) Pharma & Healthcare Includes pharmaceutical products, facilities, services, researches and biological ... biological products Also comprises establishments providing health care and social assistance for individuals as well as personal care, toiletries, and cosmetic products Media Includes establishments...
  • 28
  • 414
  • 0
Tài liệu Báo cáo khoa học: Olfactory receptor signaling is regulated by the post-synaptic density 95, Drosophila discs large, zona-occludens 1 (PDZ) scaffold multi-PDZ domain protein 1 pptx

Tài liệu Báo cáo khoa học: Olfactory receptor signaling is regulated by the post-synaptic density 95, Drosophila discs large, zona-occludens 1 (PDZ) scaffold multi-PDZ domain protein 1 pptx

Báo cáo khoa học

... of cells, forming clusters at the cell surface (Fig 2A, B) Approximately 5% of transfected cells exhibited this translocation effect of MUPP1-GFP This apparently low proportion of cells reflects ... MUPP1 could exhibit alternative effects on the dynamics of calcium responses induced by ORs in the neurons compared to those induced by heterologously expressed ORs The observed effects can therefore ... 5¢-CAAAACGCTCTACAGGC TCC-3¢, 5¢-GAAGAGCTGGACAGAGGTGG-3¢ (ZO-1), 5¢-TTATGGGCCACCGGATATTA-3¢, 5¢-GGAGAGTCA CTGAAGGCTGG-3¢ (DLG-2), 5¢-AAGCTAAGAGGCA CGGAACA-3¢, 5¢-TCCTTATTGCCAGCGAGACT-3¢ (Patj), 5¢-TTGCAGACGGAAGAGGTTCT-3¢,...
  • 12
  • 543
  • 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Báo cáo khoa học

... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF-A141Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q146A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... Monod, Paris, France) as template DNA MnSOD was cloned using the primers ECM-5¢ d(5¢-AGCTATACCCTGCCATCCCTG) and ECM-3¢ d(5¢-TTATTTTTTCGCCGCAAAACGTG) and E coli genomic DNA as template PCR was carried ... isolated by PCR FeSOD was cloned using the primers ECF-5¢ d(5¢-TCATT CGAATTACCTGCACTAC) and ECF-3¢ d(5¢-TTATGC AGCGAGATTTTTCGCT) and the sodB plasmid, pHS1-8 (supplied by D Touati, Institut Jacques...
  • 12
  • 740
  • 0
Báo cáo khoa học: Androgen receptor function is modulated by the tissue-specific AR45 variant ppt

Báo cáo khoa học: Androgen receptor function is modulated by the tissue-specific AR45 variant ppt

Báo cáo khoa học

... to poor coactivator recruitment, due to the absence of the NTD This might be overcome by the overexpression of cofactors To test this hypothesis, we analyzed the effects of two AR cofactors known ... C; five cycles of s at 94 C, 10 s at 70 C, at 72 C; 23 cycles of s at 94 C, 10 s at 68 C, at 72 C The following primers were used for AR, 5¢-GGGTGAGGATGGTTCTCCCC-3¢ and 5¢-CTGGACTCAGATGCTCC-3¢ ... (Stratagene) The following primers were used for AR45: 5¢-ACA GGGAACCAGGGAAACGAATGCAGAGTGCTCCTGA CATTGCCTGT-3¢ and 5¢-TCACTGGGTGTGGAAATA GATGGGCTTGA-3¢ Reaction conditions were: five cycles of s at 94 C, ...
  • 11
  • 514
  • 0
The aim of the research is to study the factors affecting the lifetime of pulsed plasma thruster

The aim of the research is to study the factors affecting the lifetime of pulsed plasma thruster

Hóa học

... is a new FDA approved UVA blocker Source: http://jchemed.chem.wisc.edu/JCEWWW/Features/MonthlyMolecules/2004/Oct/JCE2004p1491fig4.gif 27 28 How are inorganic sunscreen ingredients different from ... Skin cancer: • Is ~50% of all cancer cases • Has > million cases diagnosed each year • Causes person to die every hour Causes of the increase: • Decrease ozone protection • Increased time in the ... Inorganic Clusters • Maximum scattering occurs for wavelengths twice as large as the clusters – Make the clusters smaller (100 nm or less) and they won’t scatter visible light Source: Graph adapted from...
  • 44
  • 1,424
  • 0
Báo cáo khoa học: Proteolytic degradation of nitric oxide synthase isoforms by calpain is modulated by the expression levels of HSP90 potx

Báo cáo khoa học: Proteolytic degradation of nitric oxide synthase isoforms by calpain is modulated by the expression levels of HSP90 potx

Báo cáo khoa học

... acquirement of the active conformation and the fully functional state of the synthases [14–17], and recruitment of active calpain, which prevents the inactivation of NOS Discussion In the present ... associated calpain differ from that of the native enzyme because its efficiency is reduced by 50%, probably due to a lower Ca2+binding capacity This explains why higher amounts of calpain are required for ... of HSP90 (Fig 4D) The changes in catalytic properties of calpain provide an explanation of the mechanism by which, in the ternary complex form, both HSP90 and NOS isozymes are protected from calpain...
  • 12
  • 338
  • 0
This Time is Different, Again? The United States Five Years after the Onset of Subprime potx

This Time is Different, Again? The United States Five Years after the Onset of Subprime potx

Tài chính doanh nghiệp

... metrics, the aftermath of the US financial crisis has been quite typical of post-war systemic financial crises around the globe If one really wants to See Chapter 14 on the Aftermath of Financial ... positively brisk Summary of Findings We first focus on four previous systemic financial crises that the United States has experienced since 1870 These include the crisis of 1873 (called the Great ... systemic financial crises, the United States output performance is, in fact, among the best of those that did US Historical episodes As in our work on the aftermath of financial crisis (Reinhart and...
  • 9
  • 357
  • 0
This study is financed by CIP 2007-2013 Study on Accounting requirements for SMEs doc

This study is financed by CIP 2007-2013 Study on Accounting requirements for SMEs doc

Kế toán - Kiểm toán

... statements Components of financial statements Local GAAP are incorporated by Article L.123-12 and following of the French Commercial Code and the French General Chart of Accounts (so called PCG) Accrual ... Title II, Chapter III, Section 2) Local GAAP are incorporated by Article L.123-12 and following of the French Commercial Code and the French General Chart of Accounts (so called PCG) 34 FRType A ... ledgers (CoC, Book I, Title II, Chapter III, Section 2) Local GAAP are incorporated by Article L.123-12 and following of the French Commercial Code and the French General Chart of Accounts (so called...
  • 487
  • 316
  • 0
Báo cáo khoa học: The phosphatidylethanolamine level of yeast mitochondria is affected by the mitochondrial components Oxa1p and Yme1p ppt

Báo cáo khoa học: The phosphatidylethanolamine level of yeast mitochondria is affected by the mitochondrial components Oxa1p and Yme1p ppt

Báo cáo khoa học

... GTTTTATATTTTTATATTTACAGAGAGATATAGAGCCTTTATGAATTCGAGCTCGTTTAAAC GCCAGTTAAGAACGCCTTGGCGCAAGGGAGGACGCTCCTCCGGATCCCCGGGTTAATTAA CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC TCTAATACGACTCACTATAGGGAGAATGTCAATTATGCCAGTTAAG CTTTACATATGATTGCTTTCATTTTAAATCATTCTTTCC ... sequence (5¢- to 3¢) OXA1 -F1 OXA1-R1 PSD1 -F1 PSD1-R1 PSD1-T1 PSD1-U1 PSD1-RT FW PSD1-RT REV GTTCACGTACAAGCGGAGCCACAGAATAACCTCCCCGACGCGGATCCCCGGGTTAATTAA GTTTTATATTTTTATATTTACAGAGAGATATAGAGCCTTTATGAATTCGAGCTCGTTTAAAC ... PtdEtn can be affected First, is the supply of PtdSer to the mitochondria as a precursor for PtdEtn formation by Psd1p This process includes synthesis of PtdSer in the endoplasmic reticulum by the...
  • 11
  • 354
  • 0
Báo cáo khoa học: In vivo degradation of nitric oxide synthase (NOS) and heat shock protein 90 (HSP90) by calpain is modulated by the formation of a NOS–HSP90 heterocomplex pot

Báo cáo khoa học: In vivo degradation of nitric oxide synthase (NOS) and heat shock protein 90 (HSP90) by calpain is modulated by the formation of a NOS–HSP90 heterocomplex pot

Báo cáo khoa học

... reduced in the presence of equimolar amounts of HSP90 [27] Using immunoprecipitation studies, it has also been established that the protective effect is caused by HSP90-speci c recruitment by active ... resulting in the accumulation of the still active 130 kDa form, can be reproduced in in vitro conditions if nNOS digestion by calpain is carried out in the presence of HSP90 [27] This finding can also ... recovered as free protein was much lower than that engaged in the complex The large difference in the amount of free chaperone observed in the two tissues is indicative of the existence FEBS Journal...
  • 11
  • 344
  • 0
– THE GRE ANALYTICAL WRITING SECTION – The argument, as given, is weakened by the fact that it docx

THE GRE ANALYTICAL WRITING SECTION – The argument, as given, is weakened by the fact that it docx

Kỹ năng nói tiếng Anh

... valid Find the missing link between the premise and conclusion ■ Remember that a premise for one conclusion can be the conclusion of a subargument ■ Conclusions must be based on the evidence in the ... together Think about why this issue is significant and address its significance in your conclusion Think about the questions this issue raises, and address the implications of the issue in your conclusion ... argument must have a premise and a conclusion, but the premise or conclusion may be unstated ■ If the premise is missing, ask yourself if there are any assumptions that must be true for the argument...
  • 25
  • 377
  • 0
Peer Review Training – National Science Foundation August 1, 2011 Appendix C - Checklist for Review of Financial Audits Performed by the OIG potx

Peer Review Training – National Science Foundation August 1, 2011 Appendix C - Checklist for Review of Financial Audits Performed by the OIG potx

Kế toán - Kiểm toán

... Did OIG follow: checklists independent referencer other quality controls procedures This is trial version www.adultpdf.com Conclusion  The adequacy of the OIG’s policies and procedures are evaluated ... A  If reviewer concludes that the financial audit met professional standards, but… inadequate policies and procedures noncompliance with policies and procedures… what to do???? This is trial ... www.adultpdf.com Policies and Procedures Noncompliance with or inadequacies would ordinarily be reported as findings in the Letter of Comment and not impact the peer review rating This is trial...
  • 10
  • 242
  • 0
báo cáo hóa học:

báo cáo hóa học: " Astrocyte production of the chemokine macrophage inflammatory protein-2 is inhibited by the spice principle curcumin at the level of gene transcription" pptx

Hóa học - Dầu khí

... amplification (PCR) as described earlier[14] using the primers: 5'-TGCCGGCTCCTCAGTGCT-3' (forward) and 5'-GCCTTGCCTTTGTTCAGTATCTTTTG-3' (backward) In other experiments, the effect of EGCG on induced ... construct that contains canonical NFκB and NF-IL-6 cis-acting elements demonstrate that inhibition of MIP-2 by curcumin occurs at the level of gene transcription The importance of either of these ... responsible for curry's characteristic yellow color As is true of other naturally occurring polyphenolic compounds, such as caffeic acid phenyl ester, rosmaric acid and resveratrol, curcumin possesses...
  • 7
  • 385
  • 1
Báo cáo hóa học:

Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

Hóa học - Dầu khí

... ACAACAACTTTAATCTGCACACC-3’ yqhDR (Reverse) 5’-CCG CTCGAG TTAGCGGGCGGCTTC-3’ PorfXF (Forward) SppIP 5’-TGAAAATTGATATTAGCG-3’ MAGNSSNFIHKIKQIFTHR The restriction sites in the primers NcoI (forward) and XhoI ... described under “3-HPA production by resting cells of L reuteri ATCC 55730” Construction of the recombinant plasmids A schematic representation of the structure of recombinant plasmid, pHR2, carrying ... the recombinant plasmid on the host (Bentley et al 1990) Further, metabolic flux analysis needs to be carried out by measuring the enzyme activities and cofactors to verify this hypothesis The...
  • 8
  • 399
  • 0
What is meant by the case

What is meant by the case

Ngữ pháp tiếng Anh

... Here the noun Peter is used for addressing a person or thing A noun used to address a person or thing is said to be in the vocative case Be first to know when grammar rules change! Sign ... to know when grammar rules change! Sign up to our newsletter here: englishgrammar.org (It's free) Powered by TCPDF (www.tcpdf.org) ...
  • 2
  • 186
  • 0
What is meant by the case

What is meant by the case

Ngữ pháp tiếng Anh

... Here the noun Peter is used for addressing a person or thing A noun used to address a person or thing is said to be in the vocative case Stay on top of your writing! Download our grammar guide from ... Stay on top of your writing! Download our grammar guide from www.englishgrammar.org to stay up-to-date Powered by TCPDF (www.tcpdf.org) ...
  • 2
  • 143
  • 0
Under, over, by the clover (words are categorical)

Under, over, by the clover (words are categorical)

Anh ngữ cho trẻ em

... in any form or by any means—electronic, mechanical, photocopying, recording, or otherwise—without the prior written permission of Carolrhoda Books, Inc., except for the inclusion of brief quotations ... doctors rushed Rhonda’s wrecked shin Or Charlie danced the Charleston over on the green, Across the way, toward Mississippi, Through of the yard Chris, the hippie itio s s n ob epo thei r j ... Cataloging-in-Publication Data Cleary, Brian P., 1959– Under, over, by the clover : what is a preposition? / by Brian P Cleary ; illustrated by Brian Gable p cm — (Words are categorical) eISBN 1–57505–570–8...
  • 33
  • 417
  • 0
Báo cáo khoa học: Insights into the activation of brain serine racemase by the multi-PDZ domain glutamate receptor interacting protein, divalent cations and ATP ppt

Báo cáo khoa học: Insights into the activation of brain serine racemase by the multi-PDZ domain glutamate receptor interacting protein, divalent cations and ATP ppt

Báo cáo khoa học

... presence and absence of this binding protein (Fig 1C) When SR is purified in the presence of divalent cations, the addition of extra Ca2+ or Mg2+ has a limited effect on its catalytic activity The chelating ... polypeptide chain Estimation of the hydrophobic surface area with naccess from the ligplot package reveals that approximately 76% of the contact area is hydrophobic, which is typical of obligate complexes ... previous studies performed by our group [24,25] Cloning of PDZ6 into pCDNA3 The DNA of FLAG-tagged PDZ6 was amplified from the pCWori-PDZ6 construct, using 5¢-ATGCACCATCACC Activation of brain SR by...
  • 11
  • 286
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Enhancement of radiosensitivity in human glioblastoma cells by the DNA N-mustard alkylating agent BO-1051 through augmented and sustained DNA damage response" potx

Báo cáo khoa học

... manuscript LHC, MTC, MHC, and YHS did parts of the statistical analysis and helped in discussion of data YWC, SHY, PHT involved in drafting the manuscript in the section of radiotherapy techniques ... of colonies containing at least 50 cells was determined, and the plating efficiency (PE) and surviving fractions (SF) were calculated The SF of cells exposed to × nM BO-1051 for t h was calculated ... dose The actual SF measured for combinations is smaller than that expected on the basis of the treatment effects of each modality separately It indicates a significant synergistic interaction...
  • 13
  • 447
  • 0

Xem thêm