this movie clip contains graphics for printing in keyframe 2 in keyframe 1 a stop action prevents the clip from playing

Evaluation of a reproductive health awareness program for adolescence in urban Tanzania-A quasi-experimental pre-test post-test research pptx

Evaluation of a reproductive health awareness program for adolescence in urban Tanzania-A quasi-experimental pre-test post-test research pptx

Ngày tải lên : 22/03/2014, 12:20
... 15 3 girls and 1 52 boys Girls’ ages ranging from 11 to 12 was 49.7%; 13 years old was 39 .2% ; and age 14 to 16 was 11 .1% The mean age for girls was 12 . 5 (SD = 0.9) Boys’ ages ranging from age 11 ... picture drama with apron material and small group discussion This program is a feasible program for other areas in Tanzania Program evaluation Gallant and Maticka-Tydale compared reproductive health ... MI participated in reviewing and drafting the manuscript in all stages All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests...
  • 9
  • 580
  • 0
Báo cáo sinh học: "Evaluating antibiotics for use in medicine using a poloxamer biofilm model" potx

Báo cáo sinh học: "Evaluating antibiotics for use in medicine using a poloxamer biofilm model" potx

Ngày tải lên : 08/08/2014, 19:20
... 0.07 12 . 00 ± 0 .20 24 .53 ± 0 .18 25 .53 ± 0 .24 29 .67 ± 0.47 22 .13 ± 0 .24 23 .27 ± 0 .27 20 .13 ± 0.64 Poloxamer 16 .80 ± 0 .20 17 .13 ± 0 .24 18 .60 ± 0. 12 13 .53 ± 0 .18 8 .20 ± 0. 12 10 .00 ± 0 .20 10 .47 ± 0 .18 ... 0.07 Agar 10 .00 ± 0. 12 17 .80 ± 0.00 19 .27 ± 0 .13 32. 53 ± 0 .29 16 .33 ± 0. 41 11. 40 ± 0.35 11 .67 ± 0.07 21 .27 ± 0 .13 27 .20 ± 0. 12 33.47 ± 0. 71 7.40 ± 0.00 Poloxamer 9.73 ± 0 .18 11 .00 ± 0 .20 12 . 20 ... 0. 12 21. 73 ± 0 .13 9.53 ± 0 .18 9.40 ± 0 .20 10 .40 ± 0. 12 18 .53 ± 0.35 20 .40 ± 0 .23 22 .33 ± 0 .13 0.00 ± 0.00 Agar 22 .67 ± 0.94 23 .40 ± 0 .23 24 .40 ± 0. 42 35 .13 ± 0.47 28 .20 ± 0 .23 27 .40 ± 1. 11 27 .67...
  • 10
  • 256
  • 0
Báo cáo y học: "Reduced rates of primary joint replacement for osteoarthritis in Italian and Greek migrants to Australia: the Melbourne Collaborative Cohort Study" doc

Báo cáo y học: "Reduced rates of primary joint replacement for osteoarthritis in Italian and Greek migrants to Australia: the Melbourne Collaborative Cohort Study" doc

Ngày tải lên : 09/08/2014, 14:21
... 0.0 01 0. 31 (0 .24 –0.40) < 0.0 01 1.08 (1. 07 1. 09) < 0.0 01 1.07 (1. 06 1. 09) < 0.0 01 1.08 (1. 07 1. 10) < 0.0 01 1 .10 (1. 09 1. 11) < 0.0 01 1.05 (1. 03 1. 07) < 0.0 01 1 .13 (1. 12 1. 15) < 0.0 01 1.08 (0.95 1 .23 ) ... Australian population in the 20 05 census [22 ] Italian and Greek immigration increased dramatically after World War II Italian and Greek migrants arrived at Australia in the largest numbers in the ... International variation in hip replacement rates Ann Rheum Dis 20 03, 62: 222 -22 6 21 Australian Bureau of Statistics, 34 12 . 0 Migration, Australia, 20 05–06 [http://www.ausstats.abs.gov.au/ausstats/sub...
  • 8
  • 318
  • 0
Báo cáo khoa học: "Most common genotypes and risk factors for HCV in Gaza strip: a cross sectional study" potx

Báo cáo khoa học: "Most common genotypes and risk factors for HCV in Gaza strip: a cross sectional study" potx

Ngày tải lên : 12/08/2014, 04:22
... Others 1 Egypt & others 1 Total No None 15 35 Before Gaza 10 11 Egypt 13 Jordan 0 Total 11 24 No None 12 33 Before Local Egypt 13 Others 1 Local & others Egypt & others 1 Total 11 23 Local 0 Place ... Palestine In Ministry of Health Annual Report State of Palestine Ministry of Health, Gaza; 20 05 Mohamed MK, Bakr I, El-Hoseiny M, Arafa N, Hassan A, Ismail S, Anwar M, Attala M, Rekacewicz C, Zalata ... Extraction and HCV RT-PCR amplification Viral RNA was extracted from 14 0 μl serum samples using the QIAamp viral RNA Extraction kit according to the manufactures recommendations (Qiagen, Germany)...
  • 7
  • 439
  • 0
Báo cáo y học: " Endothelial Bacteremia is an independent risk factor for mortality in nosocomial pneumonia: a prospective and observational multicenter study" potx

Báo cáo y học: " Endothelial Bacteremia is an independent risk factor for mortality in nosocomial pneumonia: a prospective and observational multicenter study" potx

Ngày tải lên : 14/08/2014, 07:21
... (%) 13 (11 .1) 55 (15 .6) 0 .29 MRSA 21 (18 ) 48 ( 12 . 7) 0 .19 Streptococcus pneumoniae (1. 8) 17 (4.5) 0 .29 Gram-negative Haemophilus influenzae (1. 8) 22 (5.8) 0 .13 Pseudomonas aeruginosa Acinetobacter ... using tolerance and the variance inflation factor Variables associated with bacteremia in univariate analysis were included in a multivariate analysis for identification of independent variables ... the interaction of plasma fibrinogen with the fibrinogen-binding proteins (the clumping factor) [7] Strains carrying the clumping factor are known to cause more invasive diseases [17 ] As fibrinogen...
  • 8
  • 311
  • 0
Polymers as corrosion inhibitors for metals in different media   a review

Polymers as corrosion inhibitors for metals in different media a review

Ngày tải lên : 27/04/2015, 09:08
... (g/l) Inhibition Efficiency (%) o 30 C 40oC 50oC 60oC 0 .1 4.75 7.58 11 .59 12 . 53 0 .2 5. 62 12 . 27 15 .08 20 .05 0.3 12 . 04 13 .73 21 .00 26 .46 0.4 17 .24 19 .49 25 .08 29 .25 0.5 21 .84 25 .99 32. 92 37.88 Rajendran ... 35 .1 -4 73.5 66 .2 10 -3 86.4 77.4 10 -2 93.0 84 .2 10 -1 96.8 92. 0 10 -6 17 .7 23 .4 10 -5 75 .1 61. 1 10 -4 86.4 87 .1 -3 94.4 93.4 10 -2 97 .1 96.4 10 -1 98.4 97.3 10 -6 16 .2 14 .1 10-5 85.0 79.7 10 -4 92. 3 ... 93.9 10 -3 98 .1 96 .1 -2 98.8 97.6 10 -1 99 .2 98 .1 10-6 16 .1 43 .1 10-5 93.0 88.0 10 -4 96.8 97.7 10 -3 98.9 97.6 10 -2 99 .1 98.4 10 20 0 400 600 10 10 10 10 00 -1 - 98.8 10 -6 34.3 22 .3 10 -5 94.4 92. 8 10 -4...
  • 14
  • 424
  • 0
Tài liệu Báo cáo khoa học: "Exploiting Readymades in Linguistic Creativity: A System Demonstration of the Jigsaw Bard" docx

Tài liệu Báo cáo khoa học: "Exploiting Readymades in Linguistic Creativity: A System Demonstration of the Jigsaw Bard" docx

Ngày tải lên : 20/02/2014, 05:20
... names of racehorses, and so on, and on The 19 96 movie The Usual Suspects takes its name from a memorable scene in 19 42 s Casablanca, as does the Woody Allen play and movie Play it Again Sam The ... reinforcing The combination is indexed on AdjA1+AdjA2 Example: “as dark and sophisticated as a chocolate martini” (3) AdjA NounS where NounS denotes a cultural stereotype, and the adjective AdjA ... advocates use the hashtag #IAMSpartacus to show solidarity with users whose tweets have incurred the wrath of the law, they are appropriating an emotional line from the 19 60 film Spartacus Linguistic...
  • 6
  • 442
  • 0
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

Ngày tải lên : 07/03/2014, 06:20
... liver MAO A was amplified from a cDNA clone obtained from MRC Geneservices (Cambridge, UK) using the primers 5¢-GTCTTCGAA ACCATGGAGAATCAAGAGAAGGCGAGTATCGCGG G-3¢ and 5¢-GAGAGCTCGAGAACAGAACTTCAAGAC ... following the decrease in A4 56 Data analysis Steady-state kinetic data were fitted with the Michaelis– Menten equation using nonlinear least-squares analysis incorporated into the origin software package ... The Authors Journal compilation ª 20 08 FEBS R V Dunn et al 10 11 12 13 14 15 16 17 18 19 20 21 bound benzylamine and p-nitrobenzylamine J Neural Transm 11 4, 693–698 Ralph EC, Hirschi JS, Anderson...
  • 9
  • 327
  • 0
Báo cáo khoa học: Abundance of intrinsic disorder in SV-IV, a multifunctional androgen-dependent protein secreted from rat seminal vesicle pot

Báo cáo khoa học: Abundance of intrinsic disorder in SV-IV, a multifunctional androgen-dependent protein secreted from rat seminal vesicle pot

Ngày tải lên : 23/03/2014, 07:20
... Biochemical Aspects on the 7 72 19 20 21 22 23 24 25 26 27 28 29 30 31 32 Immunopathology of Reproduction (Spera G, Mukherjee AB, Ravagnan G & Metafora S, eds), pp 10 5 11 1 Acta Medica, Rome Ragone ... Protein databases The database of disordered proteins was created using a list of natively unfolded proteins [39] and the SWISS-PROT protein sequence data bank [64] The ideal database of globular ... 0 .2 –0 .1 22 0 .1 0 .2 0.45 0.30 0 .15 18 0.3 B factors 19 20 21 22 0 .15 0 .25 Number of contacts E 0.60 F 22 .5 Number of contacts B factors 21 D Hydrophobicity Net charge C 0.6 0.45 0.30 0 .15 –0 .15 ...
  • 12
  • 337
  • 0
báo cáo sinh học:" Human resources and the quality of emergency obstetric care in developing countries: a systematic review of the literature" potx

báo cáo sinh học:" Human resources and the quality of emergency obstetric care in developing countries: a systematic review of the literature" potx

Ngày tải lên : 18/06/2014, 17:20
... the analysis was carried out using the data extraction form and the analytical framework presented in the following section Analytical framework The concept of "quality of care" was defined in ... Organization; 20 05 AbouZahr C, Wardlaw T: Maternal mortality at the end of a decade: signs of progress? [erratum appears in Bull World Health Organ 20 01; 79( 12 ) :11 77] Bulletin of the World Health Organization ... Hussein J, Mavalankar D, Mridha MK, Anwar I, Achadi E, Adjei S, Padmanabhan P, Marchal B, et al.: Going to scale with professional skilled care [see comment][erratum appears in Lancet 20 06 Dec 23 ;368(9554) :22 10 ...
  • 12
  • 640
  • 0
báo cáo sinh học:" Work satisfaction of professional nurses in South Africa: a comparative analysis of the public and private sectors Rubin Pillay" pot

báo cáo sinh học:" Work satisfaction of professional nurses in South Africa: a comparative analysis of the public and private sectors Rubin Pillay" pot

Ngày tải lên : 18/06/2014, 17:20
... Physician and patient satisfaction as factors related to organisation of internal medicine group practices Medical Care 19 85, 23 (10 ) :11 71- 117 8 Weisman CS, Nathanson CA: Professional Satisfaction and ... Hardy MA: Job satisfaction among nursing staff in a military health care facility Military medicine 20 00, 16 5 (10 ):757-7 61 Nolan M, Nolan J, Grant G: Maintaining nurses' job satisfaction and morale ... to increase the satisfaction of nurses and consequently have a positive effect on individual, organizational and health outcomes 17 18 19 20 21 22 23 24 Competing interests The author declares...
  • 10
  • 514
  • 1
Báo cáo khoa học: "Effect of storage conditions on germination in Touki seeds (A. acutiloba Kitagawa) on the different umbel orders" pptx

Báo cáo khoa học: "Effect of storage conditions on germination in Touki seeds (A. acutiloba Kitagawa) on the different umbel orders" pptx

Ngày tải lên : 06/08/2014, 19:20
... germination and seedling emergence and growth in Angelica acutiloba Kitagawa Jpn J Trop Agr 50: 15 4 -1 62 Ojala, A (19 85) Seed dormancy and germination in Angelica archagelica subsp archangelica (Apiaceae) ... after harvesting exhibited earliest and fastest germination (13 .4 days) From one week to months after harvesting, mean germination time increased with increasing time after harvesting The mean ... compared to those on the secondary ( 91. 4%) and tertiary umbels (93 .2% ) Mean germination time P Mean germination time (days) 21 S 19 T 17 15 13 11 Fresh week month months Time after harvesting (days)...
  • 5
  • 499
  • 0
Báo cáo lâm nghiệp: "Status of an indigenous agro-forestry system in changing climate: A case study of the middle Himalayan region of Tehri Garhwal, India" potx

Báo cáo lâm nghiệp: "Status of an indigenous agro-forestry system in changing climate: A case study of the middle Himalayan region of Tehri Garhwal, India" potx

Ngày tải lên : 07/08/2014, 10:21
... 25 .00 25 0 750 12 5 .0 15 0.0 1 ,27 5 Tricosanthes anguina L Chachenda 5.00 50 15 0 25 .0 35.0 26 0 Momordica charantia L Karela 10 .00 10 0 300 50.0 70.0 520 Brassica rugosa (Roxb.) Bailey Rai 5.00 50 15 0 25 .0 ... 26 0 Spinacea oleracea L Palak 5.00 50 15 0 25 .0 35.0 26 0 Colocasia himalayensis Vegetables Chaulai Oryza sativa L Main crops Amaranthus cruentus L Pindalu 10 .00 10 0 300 50.0 70.0 520 5.00 50 15 0 ... on the rainfed land, which receives low rainfall, by retaining the moisture content in the soil and atmosphere Since the 19 70s the total cropped area in India has remained static at around 14 0...
  • 8
  • 440
  • 0
Báo cáo khoa học: "Lymphatic mapping and sentinel node biopsy in gynecological cancers: a critical review of the literature" pot

Báo cáo khoa học: "Lymphatic mapping and sentinel node biopsy in gynecological cancers: a critical review of the literature" pot

Ngày tải lên : 09/08/2014, 07:21
... and 17 % in the parametrial areas [35], whereas Levenback found 9% of the sentinel nodes in the paraaortic area, 11 % in the common iliac, 71% in the external iliac, and 9% in the parametrial area ... literature search and helped in drafting PD concept and design, editing of the article 21 All authors read and approved the final manuscript for publiction 22 23 References 10 11 12 13 14 15 16 Selman ... Although majority of the nodes are located in internal iliac and external iliac areas, nodes have been found in also presacral, parametrial and pararectal areas [33] In a sentinel node study carried...
  • 12
  • 511
  • 0
Báo cáo khoa học: "Delineation in thoracic oncology: a prospective study of the effect of training on contour variability and dosimetric consequences" potx

Báo cáo khoa học: "Delineation in thoracic oncology: a prospective study of the effect of training on contour variability and dosimetric consequences" potx

Ngày tải lên : 09/08/2014, 09:21
... found for the other critical organs (esophagus, heart and spinal cord) Delineation variability has already been analyzed, in prostate cancer [18 -19 ], breast cancer [20 ], lung cancer [15 ], and cervical ... Before 10 3.39 p = 0. 02 59.9 21 5 .2 After 99.48 p = 0.09 39. 71 20 2 .29 Before 1. 16 p = 0. 02 0.67 2. 41 After 1. 11 p = 0.09 0.44 2. 27 Before 78. 41 p < 0.0 01 58.85 91. 78 After 76.35 p < 0.0 01 40 .24 ... [15 ], and cervical cancer [ 21 ] Optimizing delineation may be done in several ways In clinical trials, clinical reference cases and a "virtual patient" (dummy run) are available for radiation-oncologists...
  • 24
  • 376
  • 0
Báo cáo y học: " Relationship of compartment-specific structural knee status at baseline with change in cartilage morphology: a prospective observational study using data from the osteoarthritis initiative" pps

Báo cáo y học: " Relationship of compartment-specific structural knee status at baseline with change in cartilage morphology: a prospective observational study using data from the osteoarthritis initiative" pps

Ngày tải lên : 09/08/2014, 14:21
... dedicated data segmentation The OA Initiative is a public-private partnership comprised of five contracts (N 01- AR -2- 225 8; N 01- AR -2- 225 9; N 01- AR -2- 226 0; N 01- AR -2- 226 1; N 01- AR -2- 226 2) funded by the ... 0.00 318 -2. 5 -0. 42 0. 026 05 -3.4 -0. 62 0.0 010 5 ccMF -2. 9 -0.35 0.00044 -2. 7 -0 .23 0. 12 0 63 -1. 8 -0 .14 0.445 02 -5.4 -0.47 010 01 cMFTC -1. 5 -0. 32 0.0 013 4 -2. 5 -0.38 0.0 12 6 1 -2. 2 -0 .29 0 .1 12 7 1 -4 .2 -0.64 ... cartilage plates from a sagittal data set in a different person: The femoro-tibial cartilages are labeled with the same colors as in (c), the patellar cartilage is labeled magenta and the trochlear...
  • 10
  • 483
  • 0
Báo cáo y học: "ACR70-disease activity score remission achievement from switches between all the available biological agents in rheumatoid arthritis: a systematic review of the literature" doc

Báo cáo y học: "ACR70-disease activity score remission achievement from switches between all the available biological agents in rheumatoid arthritis: a systematic review of the literature" doc

Ngày tải lên : 09/08/2014, 14:22
... 6, 610 ETA/IFX → ADA 60% 33% 13 % 12 % 31% ( -1. 9 ± 1. 4) 2b B [7] 25 IFX → ADA 75% 50% 33% - 5.6 → 3 .2 3b B 311 Anti-TNFα → RTX 51% 27 % 12 % 9% 15 % (ΔDAS > 1 .2) 1b A [10 ] 3 91 Anti-TNFα → ABA 50.4% 20 .3% ... 20 .3% 10 .2% 10 .0% - 1b A [11 ] 1, 046 Anti-TNFα → ABA - - - 13 .0% 56 .1% ( -2. 0) 1b A Anti-TNFα → TOC 50.0% 28 .8% 12 . 4% 30 .1% - 1b A Anti-CD20 [8] SR CTLA-4 Interleukin-6R inhibitor [ 12 ] 499 aAccording ... mainly evaluating efficacy in switching from anti-TNFα to new targeted therapies (rituximab, abatacept, and tocilizumab) The data available suggest that many of the clinical considerations and...
  • 7
  • 456
  • 0
Báo cáo y học: "The counterintuitive effect of multiple injuries in severity scoring: a simple variable improves the predictive ability of NISS" ppt

Báo cáo y học: "The counterintuitive effect of multiple injuries in severity scoring: a simple variable improves the predictive ability of NISS" ppt

Ngày tải lên : 13/08/2014, 23:20
... variables age and NISS was determined with fractional polynomial transformation Max AIS and num_inj were treated as nominal, i.e using dummy or indicator variables A binary variable expressing ... Ferrari Annamaria - Azienda Ospedaliera Santa Maria Nuova di Reggio Emilia, Ferri Enrico - Azienda Ospedaliero-Universitaria S Anna di Ferrara, Gambale Giorgio - Azienda Usl di Forlì, Gamberini Alfio ... Azienda Usl di Piacenza, Ravaldini Maurizio - Azienda Usl di Cesena, Targa Luigi - Azienda Usl di Cesena, Trabucco Laura - Azienda Ospedaliera Santa Maria Nuova di Reggio Emilia, Volpi Annalisa - Azienda...
  • 7
  • 239
  • 0
Christoph bollmeyer a HIGH RESOLUTION REGIONAL REANALYSIS FOR EUROPE AND GERMAN CREATION AND VERIFICATION WITH a SPECIAL FOCUS ON THE MOISTURE BUDGET

Christoph bollmeyer a HIGH RESOLUTION REGIONAL REANALYSIS FOR EUROPE AND GERMAN CREATION AND VERIFICATION WITH a SPECIAL FOCUS ON THE MOISTURE BUDGET

Ngày tải lên : 26/11/2015, 10:11
... 1. 875°x1.875° 21 0 ERA−40 JRA 25 TL159 T106 1. 12 5 °x1. 12 5 ° 1. 12 5 °x1. 12 5 ° 12 5 12 5 ERA−INTERIM TL255 0.703 12 5 °x0.703 12 5 ° 80 JRA−55 TL 319 0.5 625 °x0.5 625 ° 60 0.67°x0.5° 56 0.3 12 5 °x0.3 12 5 ° 35 COSMO−REA6 0.055°x0.055° ... levels The model variables are staggered on an Arakawa-C-grid (Arakawa and Lamb, 19 81; Arakawa and Lamb, 19 77) where all scalar variables Ψ are defined in the grid centre at (i, j, k) whereas the ... downscaling was performed for the year 20 11 The dynamical downscaling was initialised at 00 UTC on the 1st January 20 11 from the corresponding state of the full reanalysis and ran freely with the same...
  • 124
  • 637
  • 0