this device has a soft button specifically intended to display help

Core J2ME™ Technology & MIDP phần 1 pot

Ngày tải lên : 12/08/2014, 11:20

... java.lang.Object java.lang.Runnable (interface) java.lang.Runtime java.lang.String java.lang.StringBuffer java.lang.System java.lang.Thread java.lang.Throwable Data Type Classes java.lang.Boolean ... java.lang.Boolean java.lang.Byte java.lang.Character java.lang.Integer java.lang.Long java.lang.Short Collection Classes java.util.Enumeration (interface) java.util.Hashtable java.util.Stack java.util.Vector ... java.io.DataInputStream java.io.DataOutput (interface) java.io.DataOutputStream java.io.InputStream java.io.InputStreamReader java.io.OutputStream java.io.OutputStreamWriter java.io.PrintStream java.io.Reader java.io.Writer...

56
787
1

The linux command line - a complete introduction

Ngày tải lên : 19/03/2014, 13:43

... directory we want Pathnames can be specified in one of two ways, as absolute pathnames or as relative pathnames Let’s deal with absolute pathnames first Absolute Pathnames An absolute pathname begins ... hardware I suggest a desktop computer that is a couple of years old and has at least 256MB of RAM and 6GB of free hard disk space Avoid laptops and wireless networks if at all possible, as these are ... directory (more about that in a little bit) and a dollar sign If the last character of the prompt is a hash mark (#) rather than a dollar sign, the terminal session has superuser privileges This...

482
2.5K
0

báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc

Ngày tải lên : 18/06/2014, 19:20

... Mental health, social functioning, and disability in postwar Afghanistan JAMA 2004, 292(5):575-584 Lopes Cardozo B, Vergara A, Agani F, Gotway CA: Mental health, social functioning, and attitudes ... forward and back translation and a detailed review by the study team Forward translation into Luo was conducted by a retired education lecturer at Gulu University It was then back-translated into ... population groups Statistical significance was assumed for P values < 0.05 for all tests All statistical analysis was performed using STATA version 9.2 (Stata Corporation, College Park, Texas, USA)...

10
647
0

Báo cáo hóa học: "Approaching the MIMO Capacity with a Low-Rate Feedback Channel in V-BLAST" docx

Ngày tải lên : 23/06/2014, 01:20

... introduced rate adaptation at each antenna in V-BLAST to overcome this problem We extend their approach to both rate and power adaptations at each antenna and theoretically prove that this new scheme, ... ordering has no impact on the capacity attained by the sum of all M antennas.1 It does, however, impact the fraction of that capacity that is allocated through rate adaptation to each individual antenna ... the antenna with the smallest capacity, as dictated by the channel Hence, it is natural to consider per-antenna rate adaptation using a low-rate feedback channel Using a low-rate feedback channel,...

10
221
0

Báo cáo toán học: "On the Generalized Convolution with a Weight - Function for Fourier, Fourier Cosine and Sine Transforms" pot

Ngày tải lên : 06/08/2014, 05:20

... Transform, MC Gray Hill, NewYork, 1951 19 H M Srivastava and Vu Kim Tuan, A new convolution theorem for the Stieltjes transform and its application to a class of singular equations, Arch Math ... 15 Nguyen Xuan Thao and Nguyen Thanh Hai, Convolution for Integral Transforms and Their Application, Russian Academy, Moscow, 1997 16 Nguyen Xuan Thao and Trinh Tuan, On the generalized convolution ... Fourier, Fourier cosine and sine transforms of functions f and g has a meaning and belongs to L(R) and the factorization property holds Nguyen Xuan Thao and Nguyen Minh Khoa 424 γ F (f ∗ g)(y) =...

16
336
0

Báo cáo y học: "Long term follow up after surgery in congenitally corrected transposition of the great arteries with a right ventricle in the systemic circulation" pot

Ngày tải lên : 10/08/2014, 09:22

... second patient also had a dextrocardia, with additionally mitral and aorta regurgitation, resulting in cardiac failure, finally leading to cardiac transplantation The third patient had a pacemaker ... These three patients had an intact atrial and ventricular septum and an adequate subpulmonary outflow One patient had a dextrocardia and a long history of cardiac failure before transplantation The ... abnormal coronary arterial anatomy, to limited coronary arterial adaptation capacity or to other factors is yet unknown However, an important finding is the abnormal pattern Bogers et al Journal...

7
387
0

Báo cáo y học: " Carcinoid tumor of the verumontanum (colliculus seminalis) of the prostatic urethra with a coexisting prostatic adenocarcinoma: a case report" docx

Ngày tải lên : 11/08/2014, 14:21

... Immunoperoxidase staining specific for chromogranin A, neuron specific enolase, synaptophysin, pancytokeratin and PSA, and a special combined staining for racemase [a- methyl CoA] antigen and p63 antigen ... 130(11):1693-1706 Katayama M, Hara A, Hirose Y, Yamada Y, Kuno T, Sakata K, Morioka T, Inamine M, Shibuya C, Mori H, Yoshimi N: Carcinoid tumor in the female urethral orifice: rare case report and a review ... Immunoperoxidase staining for PSA was positive in the prostatic adenocarcinoma cells, which also were positive for racemase (a- methyl CoA) antigen and negative for p63 antigen Based on this pattern of reactivity,...

4
226
0

Báo cáo y học: "The Nordic back pain subpopulation program: Can low back pain patterns be predicted from the first consultation with a chiropractor" ppt

Ngày tải lên : 13/08/2014, 14:20

... upon prior to the data analysis and without access to any clinical information about the participants This has been described elsewhere [20] Furthermore, “LBP days” was analysed as the total number ... sick-leave during 12 weeks Data analysis Agreement regarding the diagnostic classes was evaluated both as agreement regarding the main diagnostic class (level 1) and in relation to all chosen classes ... participating chiropractors Susanne Bach Helgeson, Anja Borgaard Jørgensen, Bolette Brunmark, Marianne Krogsgaard Matthiesen, Bettina Miltersen, Pia Sørensen, and Kirsten Thorhauge a large thank...

8
293
0

Báo cáo khoa học: "Highly malignant soft tissue sarcoma of the extremity with a delayed diagnosis" ppsx

Ngày tải lên : 09/08/2014, 03:22

... one case of synovial sarcoma (Figure 1) and one case of alveolar soft part sarcoma showed calcification on plain radiographs In all three cases of alveolar soft part Figure A plain radiograph ... and ankle joint (three cases), the forearm (four cases), and the popliteal area (one case) Pulmonary metastasis was detected at diagnosis in all alveolar soft part sarcoma cases and in one clear ... of alveolar soft part sarcoma, two cases of myxofibrosarcoma, and one case each of high-grade leiomyosarcoma and clear cell sarcoma were transferred to our hospital after surgery or biopsy at another...

5
286
0

Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 1

Ngày tải lên : 07/11/2012, 15:06

1
459
0

Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 3

Ngày tải lên : 07/11/2012, 15:06

... being a native speaker is not always an advantage, because in an intercultural approach, the teacher needs to know something about both cultures Because this approach is comparative and is based ... applied in this study is aimed at collecting both quantitative and qualitative data to make use of analytical and exploratory- interpretive paradigms in applied linguistics The quantitative and ... intellect generally Kramsch (1992: 125) states “intercultural awareness, as a fundamental feature of language and an integral part of language learning, is important at all level.” Briefly, regardless...

40
644
1

INCORPORATING ENGLISH CULTURAL ELEMENTS INTO ENGLISH TRAINING WITH THE COMPARING CONTRASTING APPROACH a CASE OF TOURISM STUDE

Ngày tải lên : 07/09/2013, 13:41

... being a native speaker is not always an advantage, because in an intercultural approach, the teacher needs to know something about both cultures Because this approach is comparative and is based ... applied in this study is aimed at collecting both quantitative and qualitative data to make use of analytical and exploratory- interpretive paradigms in applied linguistics The quantitative and ... intellect generally Kramsch (1992: 125) states “intercultural awareness, as a fundamental feature of language and an integral part of language learning, is important at all level.” Briefly, regardless...

40
420
0

Tài liệu Troubleshooting a NIC Using the Ping Command doc

Ngày tải lên : 21/12/2013, 19:15

... important that a technician try to save as much time as possible Ping is a great utility to begin troubleshooting a problem Ping will help a technician determine whether the network problem is related ... receive a reply back? Are the values for bytes, time, and TTL the same as last time? If not, what has changed? Step If the technician can successfully ping the PC address, ... related to a bad cable, an incorrect TCP/IP setting, or a problem with a remote device Make sure to be comfortable using the Ping command and its responses - IT Essentials I v2.0 - Lab 9.7.2...

3
275
0

Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx

Ngày tải lên : 16/02/2014, 11:20

... Israeli population centers are potential against the Dimona nuclear reactor was foiled.247 targets Qassams could be used to attack Kfar Sabba and Jerusalem Katyushas could be used to attack Afula, ... of Oman U .A. E South Atlantic Ocean Democratic Republic of Congo Luanda Muskat Oman Angola Russian Federation Argentina Chile Atlantic Ocean Gulf of Riga Latvia Riga Lithuania Kaliningrad Oblast ... use joint Jordanian-Palestinian delegation Although bilateral safe passage had to carry a safe passage card or a safe and multilateral meetings followed the plenary session, passage vehicle permit...

64
307
0

Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Ngày tải lên : 20/02/2014, 02:21

... afﬁnity heparin Heparin pentasaccharide – Heparin Heparan High afﬁnity heparin Heparin pentasaccharide – Dermatan sulfate Heparin Heparin Heparin – Heparin Heparin ⁄ calcium 4 2 4 1 3 Factor Xa HCII ... Heparin cofactor II activation by dermatan sulfate Ann N Y Acad Sci 556, 116–122 60 Maimone MM & Tollefsen DM (1990) Structure of a dermatan sulfate hexasaccharide that binds to heparin cofactor ... Medical Research Council of Australia, the Australian Research Council, the National Heart Foundation of Australia (to RNP and AMB), Research Grants HL-06350 and HL-32656 from the National Institutes...

10
668
0

The World with a Thousand Moons pdf

Ngày tải lên : 06/03/2014, 00:20

... head looked queer, seeming to have a bulbous gray mass attached behind its ears Captain Walls uttered a scoffing exclamation "That's only an ordinary asteroid-cat." "That is a Vestan!" Kenniston ... fastened to the back of his neck, drop his gun and stalk stiffly away 46 toward the jungle His face was an unhuman, lifeless mask—he was a human automaton, dominated utterly by the alien creature ... readers that won him many fans, but diminished his reputation in later years when science fiction moved away from its space-opera roots Hamilton was always associated with an extravagant, romantic,...

52
408
0

Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx

Ngày tải lên : 06/03/2014, 01:20

... lacUV5 and trc were ampliﬁed by PCR from vectors including the relevant genes By using primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was ... promoter was ampliﬁed from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and TEHA8: ACACCCATGGTATATCTCCTTCT, introducing restriction sites for PstI upstream and NcoI downstream of ... rpmE_R: GGGATGTTGAAACGCTT GTTG and GFP6_R: CGGTCACGAACTCCAGCAG, respectively The input of total RNA was lg A mixture containing total RNA, dNTPs (Invitrogen, Carlsbad, CA, USA) and pmol of each reverse...

11
445
0

Đề tài " The distribution of integers with a divisor in a given interval " ppt

Ngày tải lên : 06/03/2014, 08:21

... is very mild and does not a ect the volume very much It arises from taking numbers a ∈ A which have neither too many small prime factors nor too many large prime factors Lemmas 4.7 and 4.8 will ... 7/8 a1 a2 log (t /a2 + P + (a2 )) + σ σ σ a2 ∈P(e ,te ) P (a1 )≤e This proves (7.1) Next, in (7.2) write a = a1 a2 with pβ , a1 = pβ a, β≥2 so that (a1 , a2 ) = and a2 is square-free By Lemma 3.1, ... distributed This corresponds to asking for the prime divisors of n to lie all above their expected values An analogy from probability theory is to ask for the likelihood that a random walk on the real...

68
409
0

Báo cáo khoa học: The crystal structure of NlpI A prokaryotic tetratricopeptide repeat protein with a globular fold potx

Ngày tải lên : 07/03/2014, 16:20

... aaagtgaagtcc-3¢ and 5¢-attattggatccctattgctggtccgattctgccag-3¢ 3-TPR NlpI primers (residues 62–197) were 5¢-aataatccatgg gggcacagcttttatatgagcgcggag-3¢ and 5¢-aataatggatcctcactgttc cttatccgatttttcgaagtgc-3¢ ... chemically synthesized by the W M Keck Core Facility (Yale University, New Haven, CT, USA) Primers to amplify mature NlpI (residues 20–294) were 5¢-aataatccatggggagtaatacttcctggcgta aaagtgaagtcc-3¢ ... of water molecules ˚ Avearge B-factors (A2 ) Monomer A (main chain ⁄ side chains) Monomer B (main chain ⁄ side chains) Water molecules Ramachandaran plot (%) (most favoured ⁄ allowed ⁄ disallowed)...

14
433
0

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Ngày tải lên : 07/03/2014, 17:20

... 0.4 A Signiﬁcant deviations for main- and side-chain atoms in the ligand loop containing the K100 are however, observed To accommodate K100 as a ligand a number of main-chain atoms are displaced ... m ammonium sulfate X-ray diffraction data of the wt and M100K crystals were collected on an in-house beam using a MAR345 Image Plate detector The crystals were mounted in a capillary and datasets ... additional water molecule adjacent to K100 (Fig 4B) This water, wat6, is within H-bonding distance to the coordinating K100 Nf atom and also to wat3 (Table 2) Wat3 makes further H–bonding interactions...

15
509
0