thighs a patient has become confused and somewhat disoriented she has a petechial rash over the shoulders and anterior chest is she possibly allergic to the pain medication
Báo cáo khoa học: "A Hemodynamic monitoring over the past 10 years" pot
Ngày tải lên :
12/08/2014, 23:21
... pH, and even NAD+/NADH ratios can be made [17], their utility in the diagnosis of critical illness and monitoring of response to therapy have yet to be proven The linkage between these non-invasive ... at the least, focus on measures of cardiac output, arterial pressure, and SvO2 To the extent that these measures can be made continuously and in a non-invasive fashion they will enjoy a wider ... need to be done, but will probably show that these measures also aid in defining appropriate therapy when resuscitation is planned Thus, the future approaches to hemodynamic monitoring will, at the...
- 3
- 205
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
Ngày tải lên :
07/03/2014, 05:20
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... However, the majority of these proteins are likely to be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain The distinguishing feature of ... strands and 8), the final helix of the AAA domain (a helix 10) and the C-terminal helix (a helix 11) This C-terminal region of Vps4 has been defined in the PFAM database as the ‘Vps4 oligomerization...
- 23
- 490
- 0
báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx
Ngày tải lên :
09/08/2014, 01:24
... in the body and tail of the pancreas and (iv) functioning bilateral adrenal tumors, was established The patient was submitted to an exploratory laparotomy through a bilateral subcostal incision ... metastatic disease Thus, the patient underwent an exploratory laparotomy, the intraoperative ultrasonography did not disclosed any other pancreatic lesion and distal pancreatectomy and splenectomy were ... that the proliferation index was about 5%) as well as the data from the literature, the diagnosis of well-differentiated endocrine carcinoma of the pancreas was established Both adrenals glands...
- 7
- 412
- 0
Báo cáo y học: "Cardiac surgery in a patient with retroperitoneal fibrosis and heart valvulopathy, both due to pergolide medication for Parkinson''''s disease" pps
Ngày tải lên :
10/08/2014, 10:20
... Valvular heart disease and the use of dopamine agonists for Parkinson's disease N Engl J Med 2007, 356:39-46 Yamamoto M, Uesugi T, Nakayama T: Dopamine agonists and cardiac valvulopathy in Parkinson's ... ureteral catheters are showing (white arrows) while the annulus of the mechanical valves (black arrow) and the wires of the epicardial pace maker are also seen All authors: have made substantial ... studies is unclear and may be related to the lower pergolide doses used in Asian patients There are only a few reported cases of patients who had surgery for cardiac disease acquired due to medications...
- 3
- 308
- 0
báo cáo khoa học: "Fatal septicemia in a patient with cerebral lymphoma and an Amplatzer septal occluder: a case report" pdf
Ngày tải lên :
10/08/2014, 22:20
... Fatal septicemia in a patient with cerebral lymphoma and an Amplatzer septal occluder: a case report Claudia Stöllberger1*, Adam Bastovansky1 and Josef Finsterer1,2 Addresses: 1Krankenanstalt ... a patient who had already survived an SO-related thromboembolism two years previously [6] Case presentation Our patient was a 72-year-old Caucasian woman who had a hemodynamically relevant ASD ... Figure A transesophageal echocardiogram shows the left atrium (LA), parts of the mitral valve (MV), the left ventricle (LV), the ascending aorta (AO), and a thickened aortic cusp (arrow), the last...
- 10
- 247
- 0
báo cáo khoa học: "Lenalidomide induced good clinical response in a patient with multiple relapsed and refractory Hodgkin''''s lymphoma" pptx
Ngày tải lên :
10/08/2014, 22:21
... Lactate dehydrogenase (U/L) < 241 250 175 Aspartate aminotransferase (U/L) 8-30 20 16 Alanine aminotransferase (U/L) 10-36 16 Gamma-glutamyl transpeptidase (U/L) 9-35 15 10 Alkaline phosphatase ... in the lungs and abdominal lymph nodes The patient has remained on continuous lenalidomide since 2008 In a follow-up examination in August 2009 she was found to be in good physical condition and ... of disease progression, the patient feels well, enjoys a good quality of life, is maintaining her university studies, and was able to go on vacation She remains on continuous lenalidomide and...
- 3
- 285
- 0
Báo cáo khoa hoc:" Topical latanoprost causes posterior movement of lens in a patient with exfoliation syndrome and subluxated lens: a case report" ppt
Ngày tải lên :
11/08/2014, 10:22
... study of ciliary body thickness after topical application of pharmacogic agents Am J Ophthalmol 1996, 121:319-321 Mishima HK, Masuda K, Kitazawa Y, Azuma I: A comparison of latanoprost and timolol ... prostaglandins in iris and ciliary muscles isolated from cat and other mammalian species Exp Eye Res 1996, 63:305-310 Lindsey JD, Kashiwagi K, Kashiwagi F, Weinreb RN: Prostaglandins alter extracellular ... Latanoprost is a prostagrandin F2-alpha receptor antagonist [2] that increases the efflux of aqueous humor through the uveoscleral route [3,4] The increase results from a re-organization of the...
- 3
- 241
- 0
Báo cáo y học: "Successful rescue therapy with tenofovir in a patient with hepatic decompensation and adefovir resistant HBV mutant" ppt
Ngày tải lên :
13/08/2014, 13:20
... for the patient, and wrote the manuscript Vincent Thibault carried out the virological analyses, helped interpret the data and participated in the writing of the manuscript Yves Benhamou and ... months after having stopped pegylated interferon, HBV-DNA rose to 8.3 log10, ALT to 10 ULN and aspartate aminotransferase to ULN Prothrombin time was 78%, and total bilirubin and serum albumin ... Thierry Poynard helped interpret the data and critically revised the manuscript All authors read and approved the final manuscript References 10 11 12 13 Locarnini S, Hatzakis A, Heathcote J,...
- 4
- 217
- 0
Báo cáo y học: "A systematic review of the impact of sedation practice in the ICU on resource use, costs and patient safety" pptx
Ngày tải lên :
13/08/2014, 20:21
... that generally decrease sedation dose and duration, and risk of ICU-acquired pneumonia is probably decreased by such strategies The quality and nature of standard care, and patient case-mix, are ... improvements across all ventilation and patient stay outcomes in most studies suggest that a systematic management approach is clinically important The available data also support an association between ... improvement associated with the study (the Hawthorne effect), but also potentially an artificial decrease in sedation quality in the control group compared with standard care These factors emphasise the...
- 11
- 258
- 0
Natural botanical products have a long history in the world and are featured in using a complex
Ngày tải lên :
03/11/2012, 09:54
... analysis Statistical significance between the treatment groups was analyzed using a two-way statistical analysis of variance (ANOVA), followed by Dunnett t-test and post-hoc analysis when necessary ... treatment groups They were fed intragastrically (i.g.) daily for 14 and 28 days Tumor areas were measured every days using a caliper, and the tumor area was calculated according to the formula: ... Introduction Natural botanical products have a long history in the world and are featured in using a complex combination of herbs to treat various diseases (e.g rheumatoid arthritis, menopausal symptoms,...
- 9
- 712
- 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly
Ngày tải lên :
03/04/2013, 21:06
... regular aroma samples first and half ate the heightened aroma samples first The subjects were asked to rate one sample a day at any time of the day they wanted Similarly to the tasting sessions, As ... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... ethyl alcohol, PEA) and liking of the vanilla beverage at any phase of the study The aim of the present study was to examine the effects of heightened aroma concentration on the pleasantness and...
- 10
- 599
- 1
Reducing bureaucracy and encouraging a proactive attitude throughout the workplace
Ngày tải lên :
05/04/2013, 14:58
... not want to change is that Vietnam has come out from thousand of years in the feudal regime , where the king and the mandarins had power and privileges over the other and people think that makes ... especially managers have a common vision, and are allowed to make their own targets according to the company vision, they are also responsible for and paid Group Assignment on Organizational Behavior ... region and over the world This requires Vietnamese organizations to change to adapt to new situation Therefore, it is necessary for Vietnamese organizations to abandon backward management and apply...
- 19
- 358
- 0
Reducing bureaucracy and encouraging a proactive attitude throughout the workplace
Ngày tải lên :
05/04/2013, 16:14
... requested variables entered b Dependent Variable: Y Model Summary Model R R Square Adjusted R Square 939 (a) 882 735 a Predictors: (Constant), X5, X4, X1, X3, X2 Std Error of the Estimate 45180 ... Predictors: (Constant), X4 Adjusted R Square 575 Std Error of the Estimate 57202 Coefficients (a) Unstandardized Coefficients Model (Constant) X4 Standardized Coefficients B Std Error Beta 25.58 6.175 ... Correlations cho hệ số tương quan cặp ( tương quan hai tiêu thức số lượng ) Variables Entered/Removed(b) Model Variables Entered Variables Removed Method X5, X4, X1, X3, X2 (a) Enter a All requested...
- 21
- 437
- 0
A Contrastive Analysis between the Verb ‘Run’ in English and the Verb ‘Chạy’ in Vietnamese
Ngày tải lên :
06/04/2013, 08:43
... of forms and meanings of their native language and culture to the foreign language and culture- both productively and when attempting to speak the language and to act in the culture and receptively ... • What are the grammatical and semantic features of each verb and how are they similar and different in terms of these features? • What are their synonyms and idioms? • What are the implications ... requires the teachers not only to teach their learners about the language but also how to use the language To a certain extent, CA was established to meet that requirement According to Richards,...
- 52
- 1.9K
- 25
Potential biogas production from sewage sludge: A case study of the sewage treatment plant at Kwame Nkrumah university of science and technology, Ghana
Ngày tải lên :
05/09/2013, 16:11
... into a nearby river The gravels in the SF and PF are occasionally removed and cleaned There are four penstocks (Valves) at the PST which are manually operated when the tank is observed to contain ... and technology (KNUST) generates a colossal amount of waste (solid and liquid) The solid waste is dumped at a site far away from the inhabited part of campus and the liquid waste is sent to a ... potential of the sewage at the Primary Sedimentation Tank (PST) at the KNUST sewage treatment plant and its potential power production Feedstock analysis 2.1 Wastewater handling at KNUST Liquid waste...
- 8
- 879
- 1
An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel
Ngày tải lên :
07/09/2013, 13:19
... is very familiar to language teachers, and it has several advantages However, structural syllabus has its shortcomings In teaching approaches based on structural syllabus “meaning has been taught, ... language is an answer to a need to communication, and language forms are conventions established by society Language, in fulfilling its communicative role, is always related to a situation Therefore, ... process is the simple and probably the one most familiar to English teachers and it is particularly common in ESP It, according to Hutchinson and Water (1987), “aims to draw as direct a connection as...
- 43
- 591
- 1
A discourse anslysis of the linguistic features of the advertisements of food and drink in english versus vietnamese
Ngày tải lên :
26/11/2013, 13:27
... to the advertisements of food and drink as far as the language acquisition and skill training are concerned I have decided to carry out a discourse analysis of the What are the linguistic features ... STUDY This study deals with discourse analysis of the syntactic and of advertisements have pragmatic knowledge and a critical evaluation semantic features of the advertisements of food and drink ... brand’s names of the products as well as their quality and features, the examination of the stylistic devices has revealed such as rhyme, parallelism and repetition CHAPTER 5: CONCLUSIONS AND...
- 13
- 1.5K
- 1