the words in the box all appear in the passage fill each blank with a suitable words
Báo cáo sinh học: "Comparison between 68Ga-bombesin (68Ga-BZH3) and the cRGD tetramer 68Ga-RGD4 studies in an experimental nude rat model with a neuroendocrine pancreatic tumor cell line" ppt
Ngày tải lên :
18/06/2014, 18:20
... for the diagnosis of metastatic NETs The 68 Ga-DOTATOC uptake was also used as a parameter for a radionuclide therapy with 90 Y-DOTATOC Patients with lesions demonstrating an enhanced 68Ga-DOTATOC ... migration and survival during the angiogenic cascade A common feature of many integrins like ανβ3 is that they bind to extracellular matrix proteins via the three amino acid sequence arginine-glycine-aspartic ... monitoring by qualitative analysis of SUV and quantitative evaluation based on the compartmental analysis of kinetic parameters [2] However, not all tumors are 18F-FDG avid, and in particular treated tumorous...
- 23
- 350
- 0
báo cáo hóa học: " Shedding light on walking in the dark: the effects of reduced lighting on the gait of older adults with a higher-level gait disorder and controls" ppt
Ngày tải lên :
19/06/2014, 10:20
... fear of falling that appears to be related to this increased stride variability, and have an increased risk of falls [8,9] Further, the extrapyramidal, limbic systems, and the frontal lobe apparently ... repeated measures For each gait parameter, a separate model was applied The dependent variable was the gait parameter and the independent variables were the group (patients or controls), the walking ... at least during gait termination, may also be increased when lighting is not adequate [12] These changes are reminiscent of the walking pattern of older adults with a HLGD and cautious gait An...
- 8
- 415
- 0
Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx
Ngày tải lên :
16/03/2014, 14:20
... have a homo-dimeric or -tetrameric structure with domain N acting as a connector By contrast, TVAI adopts a monomeric structure with domain N, a starch-binding domain, acting as an anchor in the ... TVAI has four substrate-binding sites in addition to the catalytic site They are located in the N-terminal region in domain N (site-N), at the interface between domains N and A (site-NA), in the ... suggests that domain N acts as a pullulanbinding domain as well as a starch-binding domain, and Trp65 in particular is a responsible for recognizing pullulan The affinity of pullulan for site-NA is...
- 9
- 342
- 0
Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc
Ngày tải lên :
23/03/2014, 12:20
... using the same conditions as reported [34] Determination of amino-acid sequence and MS analysis The full amino-acid sequence of the toxin was obtained by direct Edman degradation, using an automatic ... of these toxin-induced currents was analyzed by plotting the value ms after the onset of the depolarizing pulse The decaying inactivating portion of the control traces and the currents in the ... Overall, these data suggest that Cn12 behaves like a weak a Na-ScTx because it induces supplementary slow inactivation of the Na+ channel In other words, Cn12 interferes with cellular communication at...
- 13
- 434
- 0
Báo cáo sinh học: " Unusual presentation of hepatitis B serological markers in an Amerindian community of Venezuela with a majority of occult cases" doc
Ngày tải lên :
18/06/2014, 18:20
... were included, from the Orinoco Delta (DELTA), in Yucpas (JAPREIRA) and in Yanomamis (Y) and Piaroas (P) from the Amazon (AMAZ) Figure HBV core variants circulating in a Piaroa Amerindian with ... co-circulation of a wild type virus along with a variant harboring a premature stop codon at aa 42 of the core protein, and a variant exhibiting a deletion of 28 aas (aa 78–105) (Figure 3) A partial ... J Garzaro,Aff2 Email: dgarzaro@gmail.com Mar a C Duarte,Aff1 Email: mcarolad@hotmail.com Daisy M Garc a, Aff1 Email: mayilag@hotmail.com Milian C Pacheco,Aff1 Email: milianp@hotmail.com Isabelle...
- 13
- 375
- 0
Báo cáo hóa học: " Application of Evolution Strategies to the Design of Tracking Filters with a Large Number of Specifications" potx
Ngày tải lên :
23/06/2014, 00:20
... de Madrid, since 2000 There, he is also integrated in the Systems, Complex and Adaptive Laboratory, involved in artificial intelligence applications His main interests are radar data processing, ... (CV1 and CV2), and maximum RMSE during maneuver (PV) The design of a tracking filter aims at attaining a satisfactory trade-off among all specifications The quality of the design will be evaluated ... generations, enhancing system comparison within the optimization loop In other words, the noise samples used to simulate all scenarios in the RMS evaluation are the same for each individual in order...
- 14
- 342
- 0
Báo cáo toán học: "The order of monochromatic subgraphs with a given minimum degree" doc
Ngày tải lên :
07/08/2014, 07:21
... deleting M and adding the original edges with both endpoints in S Also, add to P all other vertices of V (G) \ (X ∪ S) and all their incident edges Notice that the obtained subgraph is a k-subgraph ... a [2] A Bialostocki , P Dierker and W Voxman, Either a graph or its complement is connected : A continuing saga, Mathematics Magazine, to appear [3] D W Matula, Ramsey Theory for graph connectivity, ... , d − 1, and vice versa In other words, there exists a 4(d − 1)-regular graph with n vertices, and a red-blue coloring of it, such that the red subgraph and the blue subgraph are each isomorphic...
- 8
- 310
- 0
Báo cáo y học: "Collagen-induced arthritis in C57BL/6 mice is associated with a robust and sustained T-cell response to type II collagen" pot
Ngày tải lên :
09/08/2014, 10:21
... with 2% bovine serum albumin, and then incubated with serial dilutions of test sera A standard curve was created for each assay by including serial dilutions of a reference sample on each plate ... histological outcome in the two models, hind paws were fixed, sectioned, and stained with haematoxylin and eosin In the early stages of CIA, inflammatory infiltrates were found in both the DBA/1 (Figure ... arthritic DBA/1 and B6 mice revealed that, in early arthritis (up to weeks after onset), there was a similar degree of inflammatory cell infiltration in the two strains In contrast, in late arthritis...
- 8
- 372
- 0
báo cáo khoa học: "Meniscoplasty for stable osteochondritis dissecans of the lateral femoral condyle combined with a discoid lateral meniscus: a case report" ppt
Ngày tải lên :
10/08/2014, 23:20
... normal articular continuity and contour, but softening of cartilage at the margins of the OCD within the lateral femoral condyle without breach or fibrillation was found We performed meniscoplasty ... examination at this time revealed mild tenderness to the lateral joint line, but all other test results and findings from plain radiographs were normal An MRI scan showed a complete discoid lateral meniscus ... following recovery from the surgical intervention Two years after her first operation, our patient presented with a snapping sound and intermittent pain involving her right knee A physical examination...
- 4
- 247
- 0
Báo cáo y học: " Evolution of the HIV-1 envelope glycoproteins with a disulfide bond between gp120 and gp41" pdf
Ngày tải lên :
13/08/2014, 13:20
... revertant viruses, using CA-p24 ELISA and/or the appearance of syncytia as indicators of virus replication At regular intervals, cells and filtered supernatant were stored at -80°C and virus was ... (fig 6) The side chain of residue 593 (cyan in fig 6) points towards the interior of the loop, thereby establishing an interaction with its counterparts in the other subunits at the trimer axis ... chains into the protein interior, but the glutamine side chains may rearrange to form hydrogen bonds to regain some of the lost energy Similar to Gln-Gln-Gln interactions that are present in the...
- 11
- 393
- 0
Báo cáo y học: " SIVdrl detection in captive mandrills: are mandrills infected with a third strain of simian immunodeficiency virus?" potx
Ngày tải lên :
13/08/2014, 13:20
... CATCCAATGAAAGGGAGGTTC GGACATAGGGGATGCCTATT CTGTCCATTTCTTTGGGTGC GGACTTTAGAAAGTACACTGC CATCCACTCAAAGGGAGGTTC GGATGTAGGTGATGCCTATT CTGTCCACTTCTTTGGATGC = SIVmnd2C CATCCATTCATAAGGAGGATTG 5' first ... being present in the southern part of the mandrill range, and SIVmnd2 in the northern part Drill monkeys are found in Nigeria and Cameroon separated from the mandrill territory by the Sanaga ... born in captivity Male CAS was born in 1983 at the now closed Wassenaar Zoo (The Netherlands), and moved to Artis Zoo in 1986 The female, REB, was born in Budapest Zoo (Hungary), and moved to Artis...
- 5
- 161
- 0
two-word phrasal verbs with the particle in that require into when used with an object
Ngày tải lên :
01/11/2013, 16:20
... participle sneaking in sneaked in sneaked in sneak inlinto p.v When you enter a place without anyone seeing or hearing you, you sneak in or sneak into the place When I was a kid I used to sneak ... Infinitive present tense break in -ing form past tense past participle break in & breaks in breaking in broke in broken in break inlinto p.v When you break in or break into a place, you ... broken them in yet We're breaking in a new secretary, so things have been a bit confused at our office lately broken in part.adj After you break in a new mechanical device or a car, a pair of...
- 17
- 633
- 0
Tài liệu In this lab, 2 ISDN routers are required. If ISDN routers are not available, review the lab to become familiar with the process. An Adtran Atlas550 ISDN emulator is used to simulate the switch/ISDN cloud. pdf
Ngày tải lên :
21/12/2013, 19:15
... Specifying interesting traffic for DDR Traffic must be defined as ‘interesting’ to cause the DDR interface to dialup the remote router For the moment, declare that all IP traffic is interesting using ... include any other type of interface even though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be ... see the reason for the call This information is shown for each channel: Tokyo#show dialer h Which dialer strings are associated with Dialer1? _ i What is the last status for dial...
- 8
- 419
- 0
Shooting the Sacred Cows of Money Putting a bullet in the head of bad financial advice
Ngày tải lên :
08/02/2014, 18:12
... me my house had appreciated in value Again, that’s capital gains versus cash flow And what people are finding out now that the real estate market has crashed and the value of homes has been sucked ... Involvement Doing the Real Thing 90% of what we say and Simulating the Real Experience Doing a Dramatic Presentation Active Giving a Talk 70% of what we say Participating in a Discussion Seeing it Done ... Here’s what we’re doing We get these loans, and the tenants are paying them off That’s the point Robert And they’re paying it off with after-tax dollars Ken They’re moving into our places, paying...
- 38
- 492
- 0
Tài liệu Mothers’ Investments in Child Health in the U.S. and U.K.: A Comparative Lens on the Immigrant ''Paradox'' docx
Ngày tải lên :
12/02/2014, 12:20
... Asia (India, Pakistan and Bangladesh), Africa and the Caribbean At the time of the 2001 Census, Indians were the largest minority group, followed by Pakistanis, Black Caribbeans, Black Africans ... from the Caribbean, Pakistan and Bangladesh have lower education and occupational qualifications than whites, on average, those from India, Africa and China have higher average qualifications ... biological father or cohabiting with the biological father At later ages, we distinguish among mothers who are single, married to the biological father, cohabiting with the biological father, or...
- 48
- 653
- 0
Tài liệu Guidelines for the appointment of General Practitioners with Special Interests in the Delivery of Clinical Services pdf
Ngày tải lên :
14/02/2014, 21:20
... learning to meet learning gaps identified through the professional development plan and annual appraisal d Evidence of acquisition The RCGP recommends that GPwSI in all areas maintain a personal ... Termination of Pregnancy providers IT facilities with Internet access j Clinical governance, accountability and monitoring arrangements, including links with others working in the same clinical area ... of an integrated general practice service with care being provided alongside other general medical services or as a stand-alone service located within a dedicated sexual health clinic within the...
- 11
- 489
- 0
Tài liệu Why Has The Cost of Navy Ships Risen - A Macroscopic Examination of the Trends in U.S. Naval Ship Costs Over the Past Several Decades doc
Ngày tải lên :
17/02/2014, 22:20
... Congress Cataloging -in- Publication Data Arena, Mark V Why has the cost of Navy ships risen? : a macroscopic examination of the trends in U.S Naval ship costs over the past several decades / Mark V Arena, ... for each ship type are shown in Table 1.1 Based on these values, we have calculated a real, annual growth rate (i.e., the annual increase in costs above in ation) for building these ships It ranges ... quantities, ultimately leading to a shrinking fleet size To counter the increasing cost, the Navy can target some of the main factors related to escalation, such as those related to the capability and complexity...
- 124
- 583
- 0