... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results ofthe HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... different model on the Lancaster Treebank data set The models used in this evaluation were trained with observation data from the Lancaster Treebank training set The training set and testing set are...
... this apparent paradox, including perhaps the steady-state theory It may be that the removal ofthe age paradox by the tenfold expansion ofthe extragalactic distance scale in the 1950S was the ... ofthe Heavens suggested that the nebulae 'or rather a species of them' are really circular discs about the same size and shape as our own galaxy They appear elliptical because most of them are ... points A and B are the same, draw a circle through A around galaxy 1, and another circle through B around galaxy Isotropy around galaxy requires that conditions are the same at A and at the point...
... quantitatively measured in theofthe host The size 2of the bone formationlateral view bone was also The size ofthe bone formation ofthe host bone was also quantitatively measured in the lateral ... in the lateral view using Alpha Ease FC software (Alpha Innotech, San Leandro, CA, USA) The area was calculated in relation with that in the (MC-; FGF2-) group at weeks in ratio Bone incorporation, ... phosphatase (TRAP) staining After radiographical examination, the femurs with the graft were decalcified with EDTA (ethylenediaminetetraacetic acid), and cut sagittally, then stained with hematoxylin...
... diagram ofthe application ofa nonlinear canceler ofthe hybrid echo for an ADSL transceiver system tones in the input signal and ofa finite number of samples for the estimation ofthemodel parameters ... [n] The Cramer-Rao bound is the theoretical lower bound for ˆ the variance of all unbiased estimators θ for themodel parameters θ and is determined by the diagonal elements ofthe inverse ofthe ... variance σu = 0.64 The figure reveals that there is a high covariance between the linear parameters and the third-order parameters That corresponds to the known fact that even in the case of a...
... Amjad Almusaed Archcrea Institute, Aarhus Denmark Part Passive Building Model and Thermal Insulation Improvement of Thermal Insulation by Environmental Means Amjad Almusaed1 and Asaad Almssad2 ... 20% ofthe area needs high thermal care 80% ofthe area needs low and middle thermal care Bath room 80% ofthe area needs high thermal care 20% ofthe area needs middle thermal care Table The ... room Thermal care level 80% ofthe area needs high thermal care 20% ofthe area needs middle thermal care Bed room 85% ofthe area needs high thermal care 15% ofthe area needs middle thermal care...
... Evolution ofthe ATP transporter family based on available amino acid sequences from a range of microsporidian parasites 1, Putative ancestral duplication of ATP transporters within the microsporidia ... nothing about the overall organization ofthe genome because the fragments sampled were small and only a tiny fraction ofthe genome was characterized in any one case [35,36,38] The data presented ... uncultivatable organisms from which only a handful of contaminant-free DNA can be extracted Finally, an important goal ofthe present study was to gather a large amount of genome sequence information...
... ATAGGATCCTGCTAAGACTCCCCACCGTAA2 Positive sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAATCCTGCAAAAATCCCTTCAACT3 Negative sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAAACTTTATAGATGTTTTTGTTCA3 Positive ... CGGTCATGGTGGCGAATAA Probe TCCTGCAAAAATCCCTTCAACT QPCR tag primer CCCCACTTTATAGATGTTTTTGTTCA Negative sense-specific QPCR primer FAM-TTGGTATAGCACAATCTTCTACCAGAGGTGGC-TAMRA Sequence contains an EcoRI ... than the cotton rat [19], constitutes a more practical model due to the availability ofa larger number of immunological and molecular reagents as well as the availability of transgenic animals...
... 5'TGCTCTAGATTAGAGAATGACAACATATGGATATTC -3'), Der p (5'- CCGGAATTCGCCGCCACCATGGATCAAGTCGATGTCAAAGATTGTGCC -3' and 5'TGCTCTAGATTAATCGCGGATTTTAGCATGAGTAGCAAT -3'), Der p (5'- CCGGAATTCGCCGCCACCATGATTGTTGGTGGTGAAAAAGCATTAGCTG ... CCGGAATTCGCCGCCACCATGATTGTTGGTGGTGAAAAAGCATTAGCTG -3' and 5'TGCTCTAGATTACTGTGAACGTTTTGATTCAATCCAATCGATA -3'), Der f (5'- CCGGAATTCGCCGCCACCATGGAAACAAGCGCTTGCCGTATCAATTCG -3' and 5'TGCTCTAGATTAGAGGTTGTTTCCGGCTTGGAAATATCCG -3'), Der ... http://www.clinicalmolecularallergy.com/content/4/1/4 CCGGAATTCGCCGCCACCATGGATCAAAGTCGATGTTAAAGATTGTGCC -3' and 5'- TGCTCTAGATTAATCACGGATTTTACCATGGGTAGCAAT -3'), and Der f (5'CCGGAATTCGCCGCCACCATGATTGTTGGTGGTGTGAAAGCACAAGCC...
... Pedro Soares pedromortaguasoares@gmail.com Rute Santos rutemarinasantos@hotmail.com António Oliveira-Tavares oliveiratavares@netvisao.pt Jorge Mota jmota@fade.up.pt Joana Carvalho jcarvalho@fade.up.pt ... that these results are related to the fact that many experts are programme leaders and thus, are more aware of practices that pertain to Leadership Also, experts may have been aware ofthe fact ... editing the manuscript AOT and RS managed the data collection and analysis JC participated in the coordination ofthe study and supervised the drafting and editing of manuscript All authors reviewed...
... repeats are apparently translated to form poly-asparagine, which makes up a substantial fraction of some proteins The description ofthe whole genome allows the large scale of these repeats in ... amoeba whose genome has recently been sequenced [5] Entamoeba is an intestinal parasite of mammals, causing diseases such as amoebic dysentery - an antisocial amoeba to Dictyostelium’s social amoeba, ... from the animal lineage before fungi and yeasts, but after plants From the point of view of its use as amodel organism, the evolutionary distance between Dictyostelium and human is actually...
... the per capita birth rate ofthe population, µ is the per capita disease-free death rate and ρ is the excess per capita death rate of infective class, β is the effective per capita contact rate, ... individuals who are capable of contracting the disease and becoming infective, • (I), the infective class, i.e., the class of those individuals who are capable of transmitting the disease to others, ... implies the ergodicity ofthe diffusion as well as the convergence in total variation ofthe transition probability to the invariant measure (see [6, 15]) As a result we have the following theorem...
... (Japanese), Trane (American) and Sanyo (Japanese) These are famous brands in the world market and Vietnamese consumers highly appreciate them A multinational join stock company has never had any ... providing and preceding the contracts Organizing the sales of products is another main task ofthe department • Financial and Accounting department: this department deals with all financial and accounting ... 5D The Marketing Strategy ofa multinational join stock company if they take care of their customers, market share and profits will follow Creating customer values and satisfaction is at the very...
... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property ofthe DataColumn SetNull Indicates ... to the parent table Updating the Primary Key ofa Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which the...
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R AAAAAAAAAA R R R R R R R R R R AAAAAAAAAAAAAAAAAAAAA ... T T T T T G G G G G G G G G G AAAAAAAAAAAAAAAAAAAA K K K K K K K K K K AAAAAAAAAA V V V V V V V V V V S S S S AAA S AA L L L L L L L L L L V V V V V V V V V V L ... with NADH and NADPH, but the catalytic rate constant using NADPH was only half that ofthe wild type The catalytic efciency, expressed as kcat/Km, ofthe R197E mutant using NADPH was then about...
... Proceedings of Fifth Annual Meeting ofthe North American Chapter ofthe Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings ofthe 50th Annual Meeting ofthe Association for Computational ... disambiguation In the 12th Conference ofthe European Chapter ofthe ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the...
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... glutamine to the active site location ofthe iron enzyme (Fe [A1 41Q]) has avery similar effect to removal ofthe existing glutamine and SOD activities are reasonably similar between the two mutants...
... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be themajor ... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts ofthe polar core ofthe catalytic TIM barrel of family 18 chitinases play a role ... that in the presence ofthe substrate, rotation of Asp142 towards Glu144 lowers the pKa ofthe latter by 0.8 pH units The calculated effects ofthe D140N and D215N mutations varied drastically...
... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis ofthe measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement ofthe measured and recalculated BCF data by the iteration Fig shows the...
... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a ... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... hTRXL-N may account for the formation ofa monomer, instead ofa dimer in the case of TRX Furthermore, the loss of intermolecular disulfide-bonds and the disbandment ofthe hydrophobic patch may also...