the urethane kainate seizure model as a tool to explore physiology and death associated with seizures
Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt
Ngày tải lên :
11/08/2014, 00:23
... relevant case reports and literatures are also indicated in the Ishikawa diagram so that readers can retrieve the case reports and relevant literatures easily The potential causes for secondary amenorrhea/oligomenorrhea ... information on an Ishikawa diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching ... brainstorming sessions and search in the literature to find the potential causes, then categorize these causes in an Ishikawa diagram The Ishikawa diagram can then be kept by individual learners...
- 3
- 381
- 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly
Ngày tải lên :
03/04/2013, 21:06
... first and half ate the heightened aroma samples first The subjects were asked to rate one sample a day at any time of the day they wanted Similarly to the tasting sessions, As the final task in the ... PEA) and liking of the vanilla beverage at any phase of the study The aim of the present study was to examine the effects of heightened aroma concentration on the pleasantness and intake of a ... more than the sample with regular aroma concentration The hypothesis was based on studies by De Graaf et al (1994, 1996) and Griep, Mets, and Massart (1997) and Schiffman and Warwick (1993), all...
- 10
- 599
- 1
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
Ngày tải lên :
19/02/2014, 17:20
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified...
- 12
- 616
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
Ngày tải lên :
22/03/2014, 12:20
... on diseases. Finally, the impact and area of impact are important for the aquaculture, agriculture, industries and other land users. Based on these criteria and the preference ... The responsibility of the scientists is to screen among these alternatives the feasible measures based on applicability and suitability for the local conditions. 2.4. Evaluation criteria After the problem and its constraints have ... noted that MCA is subjective in its nature. In case the quantitative data are available, quantitative analysis (i.e. numerical modelling) can be used in combination with MCA to arrive at the ʺbestʺ solution(s) in the ...
- 13
- 487
- 0
Báo cáo y học: "The Mammalian Phenotype Ontology as a tool for annotating, analyzing and comparing phenotypic information" potx
Ngày tải lên :
14/08/2014, 14:21
... o cardiac development is normal prior to the development of vascular defects abnormal vasculature o abnormal vascular dilation noted at E8.5 o vascular dilation was associated with an increased ... gene annotation [14] In addition, MGD has adopted the Mouse Embryo Anatomy Nomenclature Database [15] and the Anatomical Dictionary for the Adult Mouse [16] for annotating data that include anatomical ... serves as the authoritative source for the names and symbols associated with mouse genes, alleles and strains The advantage of applying such nomenclatures has been increasingly recognized as genomes...
- 9
- 264
- 0
Báo cáo khoa học: "Hyperglycaemic index as a tool to assess glucose control: a retrospective study" docx
Ngày tải lên :
12/08/2014, 20:20
... in the present study The mean age was 55 years (standard deviation 19 years) and 65% were male Table lists the demographical data and glucose-related measures for survivors and nonsurvivors APACHE ... that possess a patient database management system that can provide automated input for the HGI calculation The fact that HGI expresses glucose regulation as a single value has methodological advantages ... were obtained from the central laboratory database Therapeutic protocol Patients were fed enterally as soon as possible Total parenteral nutrition was only given when enteral nutrition failed Concentrated...
- 6
- 264
- 0
Báo cáo y học: " Factor correction as a tool to eliminate between-session variation in replicate experiments: application to molecular biology and retrovirology" ppsx
Ngày tải lên :
13/08/2014, 09:21
... Mean (and SEM) of the data of the molecular-biology data set from Figure A: original data B: normalised data C: standardised data D: data after factor correction Note that normalisation, standardisation, ... was measured in different sessions In simulating data, the overall mean was set to 100 and the standard deviation was set to 10 Factors and condition effects are given in the table The estimated ... results because the maximum likelihood approach assigns part of the variation to the estimated session factors The ratio approach can be seen as a special case, in which the user assumes that the multiplicative...
- 8
- 304
- 0
The Food Marketing Defense Model: Integrating Psychological Research to Protect Youth and Inform Public Policy doc
Ngày tải lên :
16/03/2014, 01:20
... the brand These schemas are also retrieved at the time of purchase or usage, and are assumed to influence brand choice Heath (2000) posits that advertising creates these brand associations and ... Exposure to advertising with image-oriented visuals increased participants’ attitudes toward the advertisement and the brand, as well as agreement that the product category was “cool and in style” ... affect brand evaluations and choice For example, Law and Braun (2000) and Law and Braun-LaTour (2004) found that visual-only placements (i.e., a product package that appeared in the background)...
- 61
- 411
- 0
The Food Marketing Defense Model: Integrating Psychological Research to Protect Youth and Inform Public Policy docx
Ngày tải lên :
23/03/2014, 08:21
... the brand These schemas are also retrieved at the time of purchase or usage, and are assumed to influence brand choice Heath (2000) posits that advertising creates these brand associations and ... Exposure to advertising with image-oriented visuals increased participants’ attitudes toward the advertisement and the brand, as well as agreement that the product category was “cool and in style” ... affect brand evaluations and choice For example, Law and Braun (2000) and Law and Braun-LaTour (2004) found that visual-only placements (i.e., a product package that appeared in the background)...
- 61
- 260
- 0
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot
Ngày tải lên :
30/03/2014, 15:20
... of an N-terminal b-sandwich, a core (which contains a transamidation site and a Ca2+-binding site, and has a helices and b sheets in equal amounts), and two C-terminal b-barrel domains It has ... Esposito and I Caputo 132 Akagi A, Tajima S, Ishibashi A, Matsubara Y, Takehana M, Kobayashi S & Yamaguchi, N (2002) Type XVI collagen is expressed in factor XIIIa+ monocyte-derived dermal dendrocytes ... intracellular signalling and apoptosis, as well as in neurodegenerative and autoimmune diseases Consequently, its function may depend on its subcellular and cellular localization and on access to proteins...
- 17
- 440
- 0
the event safety guide (second edition) - a guide to health, safety and welfare at music and similar events
Ngày tải lên :
01/07/2014, 16:53
... important to ensure that there are adequate means of escape from all areas Consult the fire authority and local authority at an early stage Further guidance in relation to the spectator and ancillary ... access to toilets and refreshment facilities It is essential to agree the occupant capacity with the local authority and fire authority as early as possible as the means of escape arrangements are ... health and safety management and sets out a basic approach that event organisers may wish to adopt to manage safety at events Health and safety management 17 The key elements of successful health...
- 190
- 1.1K
- 0
Báo cáo hóa học: " The Armeo Spring as training tool to improve upper limb functionality in multiple sclerosis: a pilot study" ppt
Ngày tải lên :
19/06/2014, 08:20
... (e.g car racing or card playing) The mechanical-assisted training was given supplementary on customary care comprising physical and/ or occupational therapy aimed at the maintenance of general functional ... such as the MAL (although not yet fairly applicable in MS as it compares the affected with the nonaffected upper limb, whereas motor symptoms can manifest bilaterally in MS patients) and the FM ... means of the MI (normal score = 100) and the Jamar hand-held dynamometer (Biometrics Ltd., Ladysmith, USA) Upper limb functional capacity was assessed with the TEMPA, [27] the Action Research Arm...
- 8
- 678
- 0
báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt
Ngày tải lên :
20/06/2014, 15:20
... statistical analysis and drafted the manuscript TO participated to conceive and design the study assisted in statistical analysis and helped to draft the manuscript PFM participated in the design and ... Factor analysis Factor analysis revealed a Kaiser-Mayer-Olkin value of 0.79, which as a measures for the degree of common variance, indicates that the item-pool seems to be suitable for a factorial ... that an R-S- attitude was associated with the lowest engagement scores for all five forms of a SpR practice Variance analyses confirmed that SpR attitude and religious affiliation are the main...
- 11
- 425
- 0
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot
Ngày tải lên :
10/08/2014, 10:23
... TPB model was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales If reliability was lower than 0.7, an ... intention and behaviour, because the behaviour data were at a practice level, a summary measure of intention for each practice had to be calculated This was generated in two ways – by taking the mean ... be attributed to individual primary care doctors Statistical analysis In all statistical analyses, the three targeted tests are reported and analysed separately In order to test the representativeness...
- 9
- 367
- 0
báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx
Ngày tải lên :
11/08/2014, 11:21
... controls at 575 nm was used as background The final Ca2+ amounts were calculated according to the manufacturer’sprotocol and are given in μg per μl of the sample A standard curve was prepared using ... developmental stages were divided into two parts, stigma with style and ovary, by using a razor blade The material was frozen and stored at -80°C Quantification of Ca2+ content Ca2+ content was measured ... reached the maximal values just after anther dehiscence (stage 4) At the latest analyzed stage (stage 5) a significant decrease of Ca2+ levels was observed in the upper parts of the pistil (stigma and...
- 12
- 529
- 0
Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt
Ngày tải lên :
12/08/2014, 17:22
... (5’ to 3’) Aggrecan Forward: GAGGTCGTGGTGAAAGGTGT Annealing temperature (°C) 60 Reverse: GTGTGGATGGGGTACCTGAC COL 1A1 Forward: AGGGCCAAGACGAAGACATC 62 Reverse: AGATCACGTCATCGCACAACA RNA extraction ... performed the biochemical analysis and statistical analysis, and was involved in preparation of the manuscript RP, TY and AH performed data acquisition and statistical analysis PJR participated in the ... intervals up to 12 weeks after the puncture The preoperative radiograph, which was imaged or days before the surgery, was always used as a baseline measurement A strict protocol was used to obtain...
- 9
- 402
- 0
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
Ngày tải lên :
02/11/2012, 11:12
... of the American Medical Association Influenza was not a reportable disease: the only evidence of the early occurrence was the registration of deaths reported as uncomplicated cases of pneumonia ... change to that of a respiratory airborne-virus that is adapted to the mammalian lung? Second, the viruses must adapt to environmental changes, able to withstand temperate, moisture and ph changes ... infected fowls as demonstrated by the government of China, Vietnam, and Thailand As human populations continue to increase and interactions between animals and humans become more proximate, the emergence...
- 4
- 520
- 0
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx
Ngày tải lên :
19/02/2014, 12:20
... direct stability measurements The VH domains in camelid heavy chain antibodies are most similar to the classical VH3 family and as such bind protein A with micromolar affinity Furthermore, the protein ... interaction with the specific binding partner (stability- or affinity-based), one could divide a phage library in half and sort one half against a binding partner and the other half against an expression ... indicated many statistically significant deviations from random pairing, the nature of which depended to some extent on the exact method of data normalization In contrast, the data obtained by the...
- 7
- 502
- 0