... triggered andthe basketball_mc instance becomes draggable The true parameter value used in this action causes the center ofthe basketball_mc movieclip instance to be locked tothe vertical and horizontal ... boundary = 60 Right boundary = 490 As shown by the arrows, all coordinates are based on the distance of that side from the top and left sides ofthe stage TIP An easy and visual method of determining ... basketball_mc._y = _ymouse; These two lines would cause the x and y coordinates ofthe basketball_mc movieclip instance to mimic the x and y coordinates ofthe mouse pointer, so it appears to...
... in a moment, checks whether themovieclip instance was dragged onto the canvas If so, the function creates a duplicate of that instance on top ofthe canvas and then places the original instance ... following variable at the top of Frame 1: var iconDepth:Number = 0; This variable is used to store the number of icons duplicated onto the canvas as well as to assign a unique depth toa duplicated ... important thing to remember for the next exercise After it's created, the duplicate is sent tothe same frame as the original instance so that the same icon that was dragged appears on the canvas The...
... situated symbolically at the highest point ofthe axis, clear ofthe pyramid of 34 Foundations of Oriental Art and Symbolism Galganatha Temple, Pattadakal, Karnataka, c late 7th century Surya Temple, ... represent the lunar cycle: in the mandala of 64 squares the border of 28 divisions corresponds tothe 28 lunar mansions; in the mandala of 81 squares the “domains” ofthe four guardians ofthe cardinal ... observed that this type of mandala has no central square, the “center” of time being the eternal present Figs and Mandalas of nine andof four divisions There are two mandalas that are specially favored...
... of 100 lM NAMI -A and then processed as described in materials and methods Representative autoradiograms ofthe ribonuclease protection analysis of c-myc mRNA are shown in panel A Autoradiographic ... Regulation of Ras GTP loading and Ras–Raf association in neonatal rat ventricular myocytes by G protein-coupled receptor agonists and phorbol ester Activation ofthe extracellular signal-regulated ... GAPDH gene [20] GAPDH mRNA was utilized as a constant mRNA for control Statistical analysis The statistical analysis ofthe data was performed using the unpaired Student’s t-test, assuming a...
... when a solution ofthe carbonate of soda is heated with carbonate of ammonia, and probably also when a solution ofthe bicarbonate is heated Its taste is less alkaline than that ofthe carbonate, ... separate cages, while others waited round and were caught afterwards The well-known and easily imitated call ofthe bullfinch at this season ofthe year (autumn) appears to have a greater attraction ... a quantity of wheat ears, with a foot ofthe straw attached to thorn, and, having warmed the lime, that it may spread the thinner, lime about six inches ofthe straw from the bottom ofthe ears...
... (ggggacaagtttgtacaaaaaagcaggcttcaccatgaagctttgcagcc ttgca gtccttgtacc); Reverse: C-HIS1rev and C-HIS2rev and GateHISrev (ggggaccactttgtacaagaaagctgggtcctaagatccactatgat gatgatgatgatgatgatg) The resulting ... gccgcgggatgaagctttgcagccttgcagtccttgtacc); reverse: C-HIS1rev (atgatgatgcttatcgtcatcgtccccgggctcgagaacattcctaatga cat gccaagc) and C-HIS2rev (cggggtaccttattaagatccactatgatga tgatgatgatgatgatgct tatcgtcatcgtcc) ... by an I Although accentuating the hydrophobic 786 character ofthe protein surface, the mutation induces a stabilization ofthe protein (Table and [11]) Random evolution ofthe enzyme has allowed...
... Barab´ si 2000 The large-scale organization ofa metabolic networks Nature, 406:651-654 R Jakobson and M Halle 1956 Fundamentals of Language, The Hague: Mouton and Co P Ladefoged and I Maddieson 1996 ... and Weijer, 2003) of segmental inventories have been carried out in past on the UCLA Phonological Segment Inventory Database (UPSID) (Maddieson, 1984) UPSID initially had 317 languages and was ... the x-axis denotes the degree of each node expressed as a fraction ofthe maximum degree andthe y-axis denotes the number of nodes having a given degree expressed as a fraction ofthe total number...
... and detailed rate laws (hybrid model, values in bold) The heading designates the type of load parameter varied andthe range of variation relative tothe normal value ofthe reference state The ... ATP shown in Fig According tothe exact model, the maximum ofthe ATP consumption rate appears at a 3.3-fold increased value of kATPase as compared tothe value k0 ATPase ẳ 1:6 h At values of ... mechanistic and simplied rate laws Calculation of stationary system states calculated with approximate models To check how the inaccuracies ofthe simplied rate laws translate into inaccuracies of...
... SLC2 2A1 6h, the 5¢ interface is GGTACC CCCCCGGA; the 3¢ interface is ATGCCTGC GGGGATCCAC TAGTAACGGC CGCC AGTGTG CTGGAATTCT GCAGATATCC ATCACAC TGGCGGCC The cDNA of eGFP corresponds to GenBank entry ... instead of TetR-transactivator fusion proteins As clonal isolation is unnecessary and because of efficient episomal propagation ofthe Epstein–Barr vector, our approach saves 2–10 weeks of time ... eGFP, the 5¢ interface is GGTACCG CGGGCCCGGGATCCATC gccacc ATGG TGA; the 3¢ interface is CAAGTAAA GCGGCCGC For pEBTetD ⁄ eGFP, the 5¢ interface is identical; the 3¢ interface is CAAGTAAA GCGGCCGCGG...
... is to be installed – The amount of data andthe speed at which it must be transmitted – The cost ofthe media and installation 17 Local Area Network (LAN) Local Area Network (LAN) An individual ... protocols! 46 The Communication Process Protocol Data Unit (PDU) - The form that a piece of data takes at any layer PDUs are named according tothe protocols ofthe TCP/IP suite Data - Application ... App TCP Header Header Frame Trailer Data Encapsulation – Process of adding a header tothe data or any previous set of headers Decapsulation – Process of removing a header 27 Example: Protocol –...
... Primary Care R&D Consortium Authors' contributions All authors contributed substantially to (i) the conception and design ofthe study, acquisition of data and analysis and interpretation of data, ... stratified by age group and gender In individuals with participation restriction at baseline, estimates of persistence within each ofthe 11 aspects of life were calculated overall, and by age and ... older adults, we have shown that there is a substantial degree of change in participation status overa three-year period Nearly 30% of those who were participating "as and when they wanted" in all...
... rounded, to lower the accuracy Page of 10 ofthe measured data downto 5% ofthe gaitcycle The mean error of this loss of accuracy was determined to be 1,25% ofthe whole gait cycle, calculated as the ... presented The author SH is a shareholder ofthe company Authors' contributions SH conceived the device and drafted the article AW supported the draft ofthe article andthe analysis ofthe gathered data ... securing the patient lifter's belt tothe harness, standing up with the assistance ofthe therapist, anda last check before starting therapy The trajectories ofthe foot plates during the floor walking...
... quality of intrapartum obstetric care services In Botswana, 97% of pregnant mothers have access to antenatal care and 94% to safe institutional delivery whereas in Addis Ababa, 90% mothers have access ... In a doubleblind, randomized, placebo-controlled trial conducted in South Africa, Uganda and Tanzania, the rate of MTCT was 8.9% in the group where mothers and infants initiated the intrapartum ... demographic and obstetric characteristics ofthe mothers enrolled in the study The median age ofthe mothers was 25 years andthe median schooling completed was Grade The majority ofthe mothers...
... correlation between QOL measures and adverse health outcomes Aim of this study was to evaluate the ability ofthe overall QOL andofthe HRQOL to predict at a oneyear follow -up, in an older outpatient ... (33%) had at least one admission tothe ED and 46 (25%) at least one hospitalisation At unadjusted analyses the lowest score-based quartile ofthe OPQOL total score was associated with a greater ... Rodriguez-Artalejo F, Guallar-Castillon P, Pascual CR, Otero CM, Montes AO, Garcia AN, et al: Health-related quality of life as a predictor of hospital readmission and death among patients with heart...
... Rasch scores are computed for each dimension and for the overall score and are transformed into T-values with a mean of 50 and standard deviation (SD) of 10 The T scores refer tothe mean values ... conception and design ofthe study EVO, SRF, GV and JAPV analyzed the data EVO, JMV, MH, MF, LR and JA participated in the drafting ofthe article All authors contributed toa critical Page of revision ... Barcelona, Spain 3Agency for Health Information, Assessment and Quality, Barcelona, Spain 4NIHR School for Primary Care Research, Department of Primary Care, Division of Primary Care and Public Health,...
... representation of Sp2n [1, 7] The result for up- down tableaux is not quite the same as for standard tableaux In a random up- down tableau of size N with at most n rows, the probability that the tableau ... asymptotic for Brownian motion (appropriately normalized so that the random walk andthe Brownian motion have the same variance) started at η in the same chamber to remain in the chamber upto time N We ... good to within a factor of + O(N −1/2 ), and both are positive everywhere in the chamber, so the integrals of g and h agree to within the same factor, as the sums of values of g and h Thus we have...
... decidability ofthe minimum rank ofa graph overa field F was raised at the 2006 American Institute of Mathematics workshop,“Spectra of Families of Matrices described by Graphs, Digraphs, and Sign Patterns,” ... equivalent to each ofthe statements (a) -(d) Quantifier elimination (when available) allows one to verify the validity of statements ofthe form that appear in (a) -(e) Overthe complex numbers, the ... is a realization of Z over F Let V be the column space ofA Let v1 , v2 , , vk be a basis of V viewed as an E-vector space Note that V may also be viewed as a F vector space Moreover V as an...
... Braam et al examined the quality of life and salivary flow rates after irradiation of head and neck cancer overa period of years [8] At the University Hospital of Halle, Germany, in the year ... spared parotid gland These patients suffered a total damage of salivary gland function after irradiation In a further study, we have already shown that the remaining stimulated saliva in these patients ... hour after a meal at a standardized time ofthe day (9:00 am to 11:00 pm) Patients were asked to rinse the mouth and swallow any residual saliva Then, the patients were instructed to chew on a paraffin...