0

the up over and down labels of a movie clip symbol correspond to the up over and down keyframes of a button symbol

Labels of Origin for Food

Labels of Origin for Food

Nông - Lâm - Ngư

... source of the specificity of origin products, and the rationality and rationales of the management and regulation of their production and marketing The Origins of Origin The idea of place-based ... common name of the good associated with a geographical name (Parma Ham, Cherry of Lari, Tomme de Savoie) Some GIs may associate a qualifier with the common name of the good and the geographical name ... researchers and deepening their understanding of the global impacts of © CAB International 2011 Labels of Origin for Food (eds E Barham and B Sylvander) ix x B Sylvander and E Barham GIs on sustainability...
  • 236
  • 284
  • 0
Dragging a Movie Clip Instance within a Boundary

Dragging a Movie Clip Instance within a Boundary

Kỹ thuật lập trình

... triggered and the basketball_mc instance becomes draggable The true parameter value used in this action causes the center of the basketball_mc movie clip instance to be locked to the vertical and horizontal ... boundary = 60 Right boundary = 490 As shown by the arrows, all coordinates are based on the distance of that side from the top and left sides of the stage TIP An easy and visual method of determining ... basketball_mc._y = _ymouse; These two lines would cause the x and y coordinates of the basketball_mc movie clip instance to mimic the x and y coordinates of the mouse pointer, so it appears to...
  • 7
  • 221
  • 0
Dragging and Dropping Movie Clip Instances

Dragging and Dropping Movie Clip Instances

Kỹ thuật lập trình

... in a moment, checks whether the movie clip instance was dragged onto the canvas If so, the function creates a duplicate of that instance on top of the canvas and then places the original instance ... following variable at the top of Frame 1: var iconDepth:Number = 0; This variable is used to store the number of icons duplicated onto the canvas as well as to assign a unique depth to a duplicated ... important thing to remember for the next exercise After it's created, the duplicate is sent to the same frame as the original instance so that the same icon that was dragged appears on the canvas The...
  • 6
  • 245
  • 0
Foundations of Oriental Art & Symbolism

Foundations of Oriental Art & Symbolism

Mỹ thuật

... situated symbolically at the highest point of the axis, clear of the pyramid of 34 Foundations of Oriental Art and Symbolism Galganatha Temple, Pattadakal, Karnataka, c late 7th century Surya Temple, ... represent the lunar cycle: in the mandala of 64 squares the border of 28 divisions corresponds to the 28 lunar mansions; in the mandala of 81 squares the “domains” of the four guardians of the cardinal ... observed that this type of mandala has no central square, the “center” of time being the eternal present Figs and Mandalas of nine and of four divisions There are two mandalas that are specially favored...
  • 150
  • 262
  • 0
Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt

Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt

Báo cáo khoa học

... of 100 lM NAMI -A and then processed as described in materials and methods Representative autoradiograms of the ribonuclease protection analysis of c-myc mRNA are shown in panel A Autoradiographic ... Regulation of Ras GTP loading and Ras–Raf association in neonatal rat ventricular myocytes by G protein-coupled receptor agonists and phorbol ester Activation of the extracellular signal-regulated ... GAPDH gene [20] GAPDH mRNA was utilized as a constant mRNA for control Statistical analysis The statistical analysis of the data was performed using the unpaired Student’s t-test, assuming a...
  • 10
  • 703
  • 0
PRACTICAL TAXIDERMY A MANUAL OF INSTRUCTION TO THE AMATEUR IN COLLECTING, PRESERVING, AND SETTING UP NATURAL HISTORY SPECIMENS OF ALL KINDS doc

PRACTICAL TAXIDERMY A MANUAL OF INSTRUCTION TO THE AMATEUR IN COLLECTING, PRESERVING, AND SETTING UP NATURAL HISTORY SPECIMENS OF ALL KINDS doc

Cao đẳng - Đại học

... when a solution of the carbonate of soda is heated with carbonate of ammonia, and probably also when a solution of the bicarbonate is heated Its taste is less alkaline than that of the carbonate, ... separate cages, while others waited round and were caught afterwards The well-known and easily imitated call of the bullfinch at this season of the year (autumn) appears to have a greater attraction ... a quantity of wheat ears, with a foot of the straw attached to thorn, and, having warmed the lime, that it may spread the thinner, lime about six inches of the straw from the bottom of the ears...
  • 363
  • 612
  • 0
Báo cáo khoa học: Limited mutagenesis increases the stability of human carboxypeptidase U (TAFIa) and demonstrates the importance of CPU stability over proCPU concentration in down-regulating fibrinolysis doc

Báo cáo khoa học: Limited mutagenesis increases the stability of human carboxypeptidase U (TAFIa) and demonstrates the importance of CPU stability over proCPU concentration in down-regulating fibrinolysis doc

Báo cáo khoa học

... (ggggacaagtttgtacaaaaaagcaggcttcaccatgaagctttgcagcc ttgca gtccttgtacc); Reverse: C-HIS1rev and C-HIS2rev and GateHISrev (ggggaccactttgtacaagaaagctgggtcctaagatccactatgat gatgatgatgatgatgatg) The resulting ... gccgcgggatgaagctttgcagccttgcagtccttgtacc); reverse: C-HIS1rev (atgatgatgcttatcgtcatcgtccccgggctcgagaacattcctaatga cat gccaagc) and C-HIS2rev (cggggtaccttattaagatccactatgatga tgatgatgatgatgatgct tatcgtcatcgtcc) ... by an I Although accentuating the hydrophobic 786 character of the protein surface, the mutation induces a stabilization of the protein (Table and [11]) Random evolution of the enzyme has allowed...
  • 15
  • 397
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Analysis and Synthesis of the Distribution of Consonants over Languages: A Complex Network Approach" pptx

Báo cáo khoa học

... Barab´ si 2000 The large-scale organization of a metabolic networks Nature, 406:651-654 R Jakobson and M Halle 1956 Fundamentals of Language, The Hague: Mouton and Co P Ladefoged and I Maddieson 1996 ... and Weijer, 2003) of segmental inventories have been carried out in past on the UCLA Phonological Segment Inventory Database (UPSID) (Maddieson, 1984) UPSID initially had 317 languages and was ... the x-axis denotes the degree of each node expressed as a fraction of the maximum degree and the y-axis denotes the number of nodes having a given degree expressed as a fraction of the total number...
  • 8
  • 550
  • 0
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx

Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx

Báo cáo khoa học

... and detailed rate laws (hybrid model, values in bold) The heading designates the type of load parameter varied and the range of variation relative to the normal value of the reference state The ... ATP shown in Fig According to the exact model, the maximum of the ATP consumption rate appears at a 3.3-fold increased value of kATPase as compared to the value k0 ATPase 1:6 h At values of ... mechanistic and simplied rate laws Calculation of stationary system states calculated with approximate models To check how the inaccuracies of the simplied rate laws translate into inaccuracies of...
  • 15
  • 456
  • 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt

Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt

Báo cáo khoa học

... SLC2 2A1 6h, the 5¢ interface is GGTACC CCCCCGGA; the 3¢ interface is ATGCCTGC GGGGATCCAC TAGTAACGGC CGCC AGTGTG CTGGAATTCT GCAGATATCC ATCACAC TGGCGGCC The cDNA of eGFP corresponds to GenBank entry ... instead of TetR-transactivator fusion proteins As clonal isolation is unnecessary and because of efficient episomal propagation of the Epstein–Barr vector, our approach saves 2–10 weeks of time ... eGFP, the 5¢ interface is GGTACCG CGGGCCCGGGATCCATC gccacc ATGG TGA; the 3¢ interface is CAAGTAAA GCGGCCGC For pEBTetD ⁄ eGFP, the 5¢ interface is identical; the 3¢ interface is CAAGTAAA GCGGCCGCGG...
  • 8
  • 331
  • 0
Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

Báo cáo khoa học

... Pfg27C: 5¢-AAAAAGC TTATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAAAGC TTTTAAATATTGTTGTGATGTGGTTCATC-3¢ (HindIII); Pfg27D: 5¢-AAAGAATTCATGAGTAAGGTACA AAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTGT GATGTGGTTCATC-3¢ (EcoRI-PstI); ... Pfg27E:5¢-AAAC TGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAA GCTTTCACTTCGAATTCCATGGTACCAG-3¢ (PstIHindIII); Pfg27F: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAAAAGCTTTTACGACGTTGT GTGATGTGGTTCATC-3¢ (PstI-HindIII) ... CTGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAA AAGCTTAATATTGTTGTGATGTGGTTCATC-3¢ (PstIHindIII); Pfg27B: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTG TGATGTGGTTCATC-3¢ (PstI); Pfg27C: 5¢-AAAAAGC...
  • 5
  • 435
  • 0
Chapter 2Communicating Over the Network Quangkien@gmail.com.OverviewDescribe the structure of a network, including the devices and media that are necessary for successful communications. Explain the function of protocols in network communications. Ex potx

Chapter 2Communicating Over the Network Quangkien@gmail.com.OverviewDescribe the structure of a network, including the devices and media that are necessary for successful communications. Explain the function of protocols in network communications. Ex potx

Quản trị mạng

... is to be installed – The amount of data and the speed at which it must be transmitted – The cost of the media and installation 17 Local Area Network (LAN) Local Area Network (LAN) An individual ... protocols! 46 The Communication Process Protocol Data Unit (PDU) - The form that a piece of data takes at any layer PDUs are named according to the protocols of the TCP/IP suite Data - Application ... App TCP Header Header Frame Trailer Data Encapsulation – Process of adding a header to the data or any previous set of headers Decapsulation – Process of removing a header 27 Example: Protocol –...
  • 52
  • 550
  • 0
báo cáo hóa học:

báo cáo hóa học: " Onset and persistence of person-perceived participation restriction in older adults: a 3-year follow-up study in the general population" pptx

Hóa học - Dầu khí

... Primary Care R&D Consortium Authors' contributions All authors contributed substantially to (i) the conception and design of the study, acquisition of data and analysis and interpretation of data, ... stratified by age group and gender In individuals with participation restriction at baseline, estimates of persistence within each of the 11 aspects of life were calculated overall, and by age and ... older adults, we have shown that there is a substantial degree of change in participation status over a three-year period Nearly 30% of those who were participating "as and when they wanted" in all...
  • 11
  • 498
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Innovative gait robot for the repetitive practice of floor walking and stair climbing up and down in stroke patients" pdf

Hóa học - Dầu khí

... rounded, to lower the accuracy Page of 10 of the measured data down to 5% of the gaitcycle The mean error of this loss of accuracy was determined to be 1,25% of the whole gait cycle, calculated as the ... presented The author SH is a shareholder of the company Authors' contributions SH conceived the device and drafted the article AW supported the draft of the article and the analysis of the gathered data ... securing the patient lifter's belt to the harness, standing up with the assistance of the therapist, and a last check before starting therapy The trajectories of the foot plates during the floor walking...
  • 10
  • 538
  • 0
báo cáo hóa học:

báo cáo hóa học:" Current status of medication adherence and infant follow up in the prevention of mother to child HIV transmission programme in Addis Ababa: a cohort study" potx

Hóa học - Dầu khí

... quality of intrapartum obstetric care services In Botswana, 97% of pregnant mothers have access to antenatal care and 94% to safe institutional delivery whereas in Addis Ababa, 90% mothers have access ... In a doubleblind, randomized, placebo-controlled trial conducted in South Africa, Uganda and Tanzania, the rate of MTCT was 8.9% in the group where mothers and infants initiated the intrapartum ... demographic and obstetric characteristics of the mothers enrolled in the study The median age of the mothers was 25 years and the median schooling completed was Grade The majority of the mothers...
  • 10
  • 712
  • 0
báo cáo hóa học:

báo cáo hóa học: " Older People’s Quality of Life (OPQOL) scores and adverse health outcomes at a one-year follow-up. A prospective cohort study on older outpatients living in the community in Italy" docx

Hóa học - Dầu khí

... correlation between QOL measures and adverse health outcomes Aim of this study was to evaluate the ability of the overall QOL and of the HRQOL to predict at a oneyear follow -up, in an older outpatient ... (33%) had at least one admission to the ED and 46 (25%) at least one hospitalisation At unadjusted analyses the lowest score-based quartile of the OPQOL total score was associated with a greater ... Rodriguez-Artalejo F, Guallar-Castillon P, Pascual CR, Otero CM, Montes AO, Garcia AN, et al: Health-related quality of life as a predictor of hospital readmission and death among patients with heart...
  • 10
  • 694
  • 0
báo cáo hóa học:

báo cáo hóa học:" Impact of recent life events on the health related quality of life of adolescents and youths: the role of gender and life events typologies in a follow-up study" potx

Hóa học - Dầu khí

... Rasch scores are computed for each dimension and for the overall score and are transformed into T-values with a mean of 50 and standard deviation (SD) of 10 The T scores refer to the mean values ... conception and design of the study EVO, SRF, GV and JAPV analyzed the data EVO, JMV, MH, MF, LR and JA participated in the drafting of the article All authors contributed to a critical Page of revision ... Barcelona, Spain 3Agency for Health Information, Assessment and Quality, Barcelona, Spain 4NIHR School for Primary Care Research, Department of Primary Care, Division of Primary Care and Public Health,...
  • 9
  • 583
  • 0
Báo cáo toán học:

Báo cáo toán học: "Asymptotics for the distributions of subtableaux in Young and up-down tableaux" pps

Báo cáo khoa học

... representation of Sp2n [1, 7] The result for up- down tableaux is not quite the same as for standard tableaux In a random up- down tableau of size N with at most n rows, the probability that the tableau ... asymptotic for Brownian motion (appropriately normalized so that the random walk and the Brownian motion have the same variance) started at η in the same chamber to remain in the chamber up to time N We ... good to within a factor of + O(N −1/2 ), and both are positive everywhere in the chamber, so the integrals of g and h agree to within the same factor, as the sums of values of g and h Thus we have...
  • 22
  • 378
  • 0
Báo cáo toán học:

Báo cáo toán học: "Minimum rank of matrices described by a graph or pattern over the rational, real and complex numbers" doc

Báo cáo khoa học

... decidability of the minimum rank of a graph over a field F was raised at the 2006 American Institute of Mathematics workshop,“Spectra of Families of Matrices described by Graphs, Digraphs, and Sign Patterns,” ... equivalent to each of the statements (a) -(d) Quantifier elimination (when available) allows one to verify the validity of statements of the form that appear in (a) -(e) Over the complex numbers, the ... is a realization of Z over F Let V be the column space of A Let v1 , v2 , , vk be a basis of V viewed as an E-vector space Note that V may also be viewed as a F vector space Moreover V as an...
  • 19
  • 238
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Parotid gland-recovery after radiotherapy in the head and neck region: 36 months follow-up of a prospective clinical study" pdf

Báo cáo khoa học

... Braam et al examined the quality of life and salivary flow rates after irradiation of head and neck cancer over a period of years [8] At the University Hospital of Halle, Germany, in the year ... spared parotid gland These patients suffered a total damage of salivary gland function after irradiation In a further study, we have already shown that the remaining stimulated saliva in these patients ... hour after a meal at a standardized time of the day (9:00 am to 11:00 pm) Patients were asked to rinse the mouth and swallow any residual saliva Then, the patients were instructed to chew on a paraffin...
  • 25
  • 342
  • 0

Xem thêm