the threat of reescalating commitment in a large scale context
báo cáo hóa học:" Validation of the Rasch-based Depression Screening in a large scale German general population sample" doc
... the manuscript MB participated in the analysis and interpretation of the data MW participated in the design of the study and the statistical analysis HG and EB participated in the design of the ... study and coordinated the data acquisition CN contributed to the analysis and interpretation of the data SG have been involved in drafting and revising the manuscript, and coordinated the study and ... other important suggestions, they point out that a central aspect of the evaluation of clinical significant change is the returning of the patient’s score to the range of the mean plus one standard...
- 8
- 544
- 0
Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt
... expands, the correct denotational relationship is maintained by expanding the image in the table using the ~-expression, and then finding the corresponding element in the model If the element in the ... to a model has been augmented with a table that contains each ~-expression and the ima6e of its denotation in the current stage of the dynamic model When the domain of the ~-expression expands, ... that was the denotation of the h-expression was not expanded in the same way as the image in this table, a new element corresponding to the expanded image is added to the model This table allows...
- 3
- 394
- 0
THE CONSTITUTION OF LAW Legality in a Time of Emergency potx
... to interpreting the laws of apartheid illuminated debates in philosophy of law about the relationship between law and morality My main focus was on the statutory regime put in place to maintain ... required to maintain it, South African judges by and large continued to think of themselves as part of the family of the common law, proudly sustaining its traditions, including that of an independent ... of my examples are drawn are the United Kingdom, Canada, and Australia Together they present a fertile ground for testing my claims because, until quite recently, Canada and Australia had what...
- 268
- 661
- 0
THE CONSTITUTION OF LAW Legality in a Time of Emergency docx
... to interpreting the laws of apartheid illuminated debates in philosophy of law about the relationship between law and morality My main focus was on the statutory regime put in place to maintain ... required to maintain it, South African judges by and large continued to think of themselves as part of the family of the common law, proudly sustaining its traditions, including that of an independent ... of my examples are drawn are the United Kingdom, Canada, and Australia Together they present a fertile ground for testing my claims because, until quite recently, Canada and Australia had what...
- 268
- 1,134
- 0
The Art of Grief The Use of Expressive Arts in a Grief Support Group pptx
... meet the needs of the members and the facilitators is the initial planning, organization, and setting up of the group This initial stage can easily be bypassed in the interests of time and the ... logical relationship, and the feelings may come all at once in an inexplicable ball of raw emotion You may hear complaints of fatigue, exhaustion, lack of energy, pain, or inability to sleep All of ... Grief and the Sacred Art of Ritual Janet Shaw Rogers 129 Section III Alternative Art Forms, Programs, and Stories of Art and Healing Chapter 14 The Painters Deborah Koff-Chapin, Carol McIntyre, and...
- 324
- 639
- 0
báo cáo hóa học:" Quality of life and the impact of drug toxicities in a South African community-based antiretroviral programme" docx
... South Africa, there is an ongoing debate about whether or not the side-effect profile of HAART may adversely affect the HRQoL of HIVpositive individuals More data about the impact of HAART and HAARTrelated ... onto HAART and increasing survival among these patients, there is a growing need to understand the impact of HAART use on the quality of lives of HIVinfected individuals [4-8] There is a sizeable ... antiretroviral (ARV) therapy progressed to AIDS and died of their disease The rollout of highly active antiretroviral therapy (HAART) through national and provincial programmes has dramatically altered...
- 13
- 444
- 0
báo cáo hóa học:" Long term outcomes of antiretroviral therapy in a large HIV/AIDS care clinic in urban South Africa: a prospective cohort study" docx
... demonstrates that rapid scale- up of HAART using a public health approach in sub-Saharan Africa, essential to confronting the HIV/AIDS epidemic, can be accompanied by high quality care The analysis of ... of CD4 counts, viral loads, and hemoglobin from the National Health Laboratory Service database into the TherapyEdge-HIV database demonstrated high quality of data entry as 98.8% of values matched ... antiretroviral therapy (HAART) has increased dramatically, but the majority of those in need remain untreated, especially in sub-Saharan Africa With more than five million individuals living with HIV and...
- 11
- 332
- 0
báo cáo hóa học:" Quality of data collection in a large HIV observational clinic database in sub-Saharan Africa: implications for clinical research and audit of care" docx
... Diseases Institute (IDI) in Kampala, Uganda, is a centre of excellence for HIV clinical care in the country, and maintains a large observational clinic database and a nested research cohort database ... validation of key data items in these databases This evaluation is particularly timely and relevant with the expanding use of observational databases to assess the optimal timing of ART initiation, ... in the research cohort database) There was also a higher incidence and 233% better reporting of genital herpes in the routine clinic than in the research cohort database Data audit In the audit...
- 7
- 455
- 0
Báo cáo hóa học: " Application of Evolution Strategies to the Design of Tracking Filters with a Large Number of Specifications" potx
... Complex and Adaptive Laboratory, involved in artificial intelligence applications His main interests are radar data processing, navigation, and air traffic management, with special stress on data fusion ... (scenario 13), are indicated in Figures and The magnitudes with worst performance are the transversal and heading errors (peak values) during transversal maneuvers The peak value of heading error ... scenario An example is indicated in Figure 2, with the transversal error obtained through simulation and the ARTAS bounding mask for the scenario 10 Instead of measuring performance along the...
- 14
- 342
- 0
Báo cáo toán học: "COMPOSITION SUM IDENTITIES RELATED TO THE DISTRIBUTION OF COORDINATE VALUES IN A DISCRETE SIMPLEX" pptx
... refer to as pictures of weight k A card of weight k is a pair consisting of a picture of weight k and a k-element subset of N that we will call the label set of the card A hand of weight n and size ... between the cardinality of the sets of hands and the cardinality of the decks For example, when dealing with labelled graphs, Dk is the set of all connected k-graphs whose vertices are labelled by ... k A card of weight k is a connected k-graph labelled by any k natural numbers Equivalently, a card can be specified as a picture and a set of natural number labels To construct the card we label...
- 14
- 348
- 0
Báo cáo lâm nghiệp: "Extended length rotation to integrate timber and pine nut production with the conservation of structural diversity in a Pinus pinea (L.) forest" pdf
... to calculate the most likely of the four rot risk classes as a function, for each fixed basal area, of the age and the dominant height of the stand, obtaining for each value of basal area a graphic ... distribution of the age of the dominant strata and the site index within the forest area can be seen in Figure The classification of the forest area in function of the stand age and the site index is ... number of pairs of samples ua and ua + d which distance from each other is within the distance lag centred at d, and z(ua ) and z(ua +d) are the values that the variable z takes at samplesua and ua...
- 9
- 462
- 0
Báo cáo toán học: "On the number of independent sets in a tree" pdf
... 0, j The number of matchings in a tree In this section, we turn to the number of matchings in a graph This is also known as the Hosoya index, or the Z-index in mathematical chemistry For a rooted ... set as a matching as well Applying the previous technique, we will show the following the electronic journal of combinatorics 17 (2010), #N18 Theorem For m ∈ N, B(m) = Z2 m There are formulae ... the electronic journal of combinatorics 17 (2010), #N18 Consider (T, r) obtained from T1 by joining a new vertex r to r1 Then ϕ(T, r) = (b, b + a) Hence, µ (a, b) ∈ D Inductively adding a leaf...
- 5
- 263
- 0
the age of turbulence adventures in a new world phần 4 docx
... of the challenge for the Treasury and the Fed, meanwhile, was to talk scores of the world's largest banks into not calling in their Korea loans All these initiatives came to a head at the same ... reserves of dollars This sequence of events led to the so-called Asian contagion, a series of financial crises that began with the collapse of the Thai baht and Malaysian ringgit in the summer of 1997 ... it off was the initial public offering of Netscape, a tiny two-year-old software maker in Silicon Valley that had al- most no revenues and not a penny of profits Netscape was actually giving...
- 57
- 391
- 0
the age of turbulence adventures in a new world phần 6 pdf
... heavily invested in loans backed by real estate as collateral, as real estate prices soared When the turn came and prices cascaded downward, the collateral became inadequate But instead of calling ... which are already prominent in this book Australia and New Zealand are particularly interesting in how they developed after adopting market-opening reforms and gradually increasing ties with Asia, ... history and the culture it has spawned By culture, I mean the shared values of members of a society that are inculcated at an early age and that pervade all aspects of living Some aspects of a nation's...
- 57
- 404
- 0
the age of turbulence adventures in a new world phần 8 ppt
... global trading partners, and that calls for a broader explanation of the causes of U.S income inequality Part of the explanation is the more elaborate welfare systems, especially in Europe, that ... But by then, they are all too visible The rapid pace of globalization of trade is being more than matched by an expanding degree of globalization of finance An effective global financial system ... stock, the fairly dramatic decline in the average age of the stock, and the creation as a consequence of a high degree of insecurity for those individuals in the labor markets who have to deal with...
- 57
- 396
- 0
the age of turbulence adventures in a new world phần 10 ppsx
... central planning throughout the world, with China and India in the vanguard The evidence of increasing property rights, and the rule of law more generally leading to increasing levels of material well-being ... implicit in one's current undertaking and pay a royalty to the originator of each one Rather than adopting that obviously unworkable approach, Americans have chosen instead to follow the lead of British ... decades ago was equal to that of China, but is now less than half of China's and still losing ground It is conceivable that India can undergo as radical a reform as China and become world-prominent...
- 48
- 338
- 0
Báo cáo y học: "Acquired hemophilia as the cause of lifethreatening hemorrhage in a 94-year-old man: a case report" pot
... patient data and was a major contributor in writing the manuscript JR analyzed the patient data and contributed in writing the manuscript RP and BE analyzed and interpreted the patient data and were ... discharge, his bradycardia had reversed and his heart rate had increased to 85 beats/minute, which suggests that the initial bradycardia was likely related to the infusion of aminocaproic acid ... etiology of acquired hemophilia A remains unclear In approximately half of cases, factor VIII autoantibodies occur in patients without any identifiable cause, while the remaining cases may be associated...
- 4
- 496
- 0
Báo cáo y học: "Acquired hemophilia as the cause of lifethreatening hemorrhage in a 94-year-old man: a case report" potx
... patient data and was a major contributor in writing the manuscript JR analyzed the patient data and contributed in writing the manuscript RP and BE analyzed and interpreted the patient data and were ... discharge, his bradycardia had reversed and his heart rate had increased to 85 beats/minute, which suggests that the initial bradycardia was likely related to the infusion of aminocaproic acid ... etiology of acquired hemophilia A remains unclear In approximately half of cases, factor VIII autoantibodies occur in patients without any identifiable cause, while the remaining cases may be associated...
- 4
- 397
- 0
Báo cáo khoa hoc:" Study of the impact of perilipin polymorphisms in a French population" docx
... rs4578621 F : CAAGCTGGGTGCACTGGC 185 R : GAGAAATAGAGGAATTAACC rs6496589 F : CTGCCAACACTCG AGCTG 110 R : ACCTGACTCTTCCTTGTCT rs894160 F1 : GCTGAGACTGAGTCACATGC 403 R1 : GCTGAGACTGAGTCACATGC F2 : CTGTTTGTGGGGCTCCCTCG ... et al reported that the A allele was associated with enhanced basal and noradrenaline-induced lipolysis in human subcutaneous fat cells [7], it does not seem to have a major impact in human French ... Paris, France (available at http://gene canvas.ecgene.net/downloads.php) Statistical significance was defined at the 5% level Power calculation was done with the Epi Info 6.04 software available...
- 6
- 320
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25