the significance of radiobiology and radiotherapy for cancer treatment

Tài liệu The Significance of Privatization and Commercialization Trends for Women’s Health ppt

Tài liệu The Significance of Privatization and Commercialization Trends for Women’s Health ppt

Ngày tải lên : 13/02/2014, 06:20
... were then told the water was unsafe for use in baby formulas, for the elderly, and for the sick (Foller, 2003) As women are overwhelmingly the caregivers for infants and for the sick and frail, these ... facility because of concerns about the water source and the design of the treatment plant (Office of the Auditor Women and Health Care Reform and NNEWH – Women and Water in Canada General of Canada, ... most parts of the world, women are the majority of water providers for their families and are responsible for obtaining safe drinking water (Kattau, 2006) Women often the budgeting for the various...
  • 23
  • 641
  • 0
Tài liệu The Acquisition of Drugs and Biologics for Chemical and Biological Warfare Defense - Department of Defense Interactions with the Food and Drug Administration doc

Tài liệu The Acquisition of Drugs and Biologics for Chemical and Biological Warfare Defense - Department of Defense Interactions with the Food and Drug Administration doc

Ngày tải lên : 17/02/2014, 11:20
... changes in the Office of the Secretary of iii iv The Acquisition of Drugs and Biologics for CBW Defense Defense (OSD) to centralize the authority for interactions between DoD and FDA The interviews ... information about the composition or chemical structure of the drug or biologic; how the compound is manufactured; the methods of testing for safety (and for purity and potency in the case of ... recipients of IND drugs, medical monitoring and reporting of the use of such drugs, information about shipment and storage of drugs, disposition of unused IND drugs, and submission of annual and other...
  • 99
  • 600
  • 0
Tài liệu THE ESSENTIALS OF FINANCE AND ACCOUNTING FOR NONFINANCIAL MANAGERS doc

Tài liệu THE ESSENTIALS OF FINANCE AND ACCOUNTING FOR NONFINANCIAL MANAGERS doc

Ngày tải lên : 22/02/2014, 06:20
... place when the owners of the company leave the profits of the company in the business rather than taking the money out of the company in the form of dividends The cumulative amount of this reinvestment ... letter of credit, or in the case of a supermarket or retail store, cash On the other hand, as part of the selling process, the customer may be given the opportunity to postpone paying for the products ... balance sheet date, and so the company owes them three days’ pay To reflect the existence of these debts, the company estimates their amounts as of the balance sheet date and records them in an account...
  • 299
  • 775
  • 2
Báo cáo khoa học: The importance of polymerization and galloylation for the antiproliferative properties of procyanidin-rich natural extracts doc

Báo cáo khoa học: The importance of polymerization and galloylation for the antiproliferative properties of procyanidin-rich natural extracts doc

Ngày tải lên : 07/03/2014, 05:20
... cancer prevention [39–41] However, the development of effective and safe agents for the prevention and treatment of cancer remains inefficient and costly, and falls short of the requirements for ... significantly absorbed in the intestinal tract, and reach the colon mainly intact [27] They are therefore bioavailable to the epithelial cells in the intestinal wall, where procyanidins and other phenolics ... investigated the relationship of different structural factors of procyanidins, such as the mean degree of polymerization and percentage of galloylation, with their antiproliferative potential and their...
  • 10
  • 638
  • 0
Báo cáo y học: " HIV-1 Accessory Protein Vpr: Relevance in the pathogenesis of HIV and potential for therapeutic interventio" ppsx

Báo cáo y học: " HIV-1 Accessory Protein Vpr: Relevance in the pathogenesis of HIV and potential for therapeutic interventio" ppsx

Ngày tải lên : 13/08/2014, 01:20
... and are therefore not subject to the cell-cycle arrest function of Vpr and even lack the prerequisite ATR induction in the presence of Vpr [132] The findings that demonstrate the importance of ... the minor and Page of 20 severe forms of HAND have common etiologic mechanisms, there is reason to suspect the importance of HIV infection in macrophages in the central nervous system (CNS) and/ or ... combination with the aforementioned abilities of Vpr to increase viral replication by inducing G arrest and activating the HIV-1 LTR, the potential of Vpr to promote infection of and survival of macrophages...
  • 20
  • 401
  • 0
Báo cáo y học: "Pathways to child and adolescent psychiatric clinics: a multilevel study of the significance of ethnicity and neighbourhood social characteristics on source of referral" pptx

Báo cáo y học: "Pathways to child and adolescent psychiatric clinics: a multilevel study of the significance of ethnicity and neighbourhood social characteristics on source of referral" pptx

Ngày tải lên : 13/08/2014, 18:21
... arrived during the final decade of the 20th and the first years of the 21st century from the former Yugoslavia, the former Soviet union, Iraq and Somalia [5] According to data from the Swedish National ... groups since for some children and adolescents, the available data refer only to the region of origin (e.g other Asian) In the analysis, the ethnicity measure is employed in the form of five dummy ... designed the study, performed the statistical analysis and wrote the manuscript with support from the other co-authors RS helped with the interpretation of the statistical analysis, revised the manuscript...
  • 12
  • 320
  • 0
The Use of Selected Medicinal Herbs for Chemoprevention and Treatment of Cancer, Parkinson’s Disease, Heart Disease, and Depression

The Use of Selected Medicinal Herbs for Chemoprevention and Treatment of Cancer, Parkinson’s Disease, Heart Disease, and Depression

Ngày tải lên : 25/10/2013, 05:20
... aspects of study design, performance, and analysis, with a focus on randomization of the study subjects, blinding of the investigators and study subjects, and the handling of dropouts and withdrawal ... is the common name for the flowering plant, Hypericum perforatum L (Gaster and Holroyd, 2000), a member of the Hypericaceae family Its yellow flower has been gathered for the feast of St John the ... 2004), it is not known whether digoxin will remain as the standard therapy for heart failure (Hauptman and Kelly, 1999) In the future, there might be other uses for digitoxin There is evidence that...
  • 57
  • 683
  • 0
Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx

Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx

Ngày tải lên : 18/06/2014, 16:20
... cycles of 94°C for 30 sec, 59°C for 45 sec and 72°C for 60 sec, and finally 72°C for The PCR reactions were carried out in 25 μl volumes in the presence of ng/μl of each of the forward and the reverse ... early studies of our group and others, the transcriptional regulatory sequences of the H19 and IGF2 genes emerged as candidates for cancer targeted therapy H19 and IGF2 (the human P3 and P4 promoters) ... (5’-TCCTCCTCCTCCTGCCCCAGCG), for the P4 transcript in the forward direction and the reverse primer (5’- CAGCAATGCAGCACGAGGCGAAGCC) was designed to bind the 3’ end of exon and the 5’ end of exon without the introns...
  • 18
  • 746
  • 0
báo cáo hóa học:" Research Article Automatic Speech Recognition Systems for the Evaluation of Voice and Speech Disorders in Head and Neck Cancer" pdf

báo cáo hóa học:" Research Article Automatic Speech Recognition Systems for the Evaluation of Voice and Speech Disorders in Head and Neck Cancer" pdf

Ngày tải lên : 21/06/2014, 20:20
... treatment for oral cancer As a precondition for the evaluation of the patient groups, the extent of disorder is widespread, as seen by the results of the perceptual assessment and the ASR results The ... compare the averaged scores of the raters and the WR even though both scales differ in their order of magnitude Comparisons of the mean values were performed using Student’s T-test The test for normal ... in the control group (P < 001) Inter-rater correlations were computed for each of the raters using the respective other raters as reference, that is, the mean of the four other raters for the...
  • 7
  • 566
  • 0
Báo cáo khoa học: "The evolution of rectal and urinary toxicity and immune response in prostate cancer patients treated with two three-dimensional conformal radiotherapy techniques" ppt

Báo cáo khoa học: "The evolution of rectal and urinary toxicity and immune response in prostate cancer patients treated with two three-dimensional conformal radiotherapy techniques" ppt

Ngày tải lên : 09/08/2014, 09:20
... Three-dimensional conformal radiotherapy (3DCRT) represents one of the standard treatments of prostate cancer allowing the delivery of highly “conformed” (focused) radiation to the cancer cells, while significantly ... models The list of predictive factors was the same for acute and late toxicities; except for the addition of acute toxicity, as the next predictive factor of late OAR damage The patient-, tumor-, and ... Other important predictors of acute GI toxicity were the percentage of rectum volume receiving 70 Gy (the higher the percentage of rectum, the higher the chance of high level toxicity) and the...
  • 13
  • 433
  • 0
Báo cáo khoa học: " The influence of smoking and other risk factors on the outcome after radiochemotherapy for anal cancer" ppt

Báo cáo khoa học: " The influence of smoking and other risk factors on the outcome after radiochemotherapy for anal cancer" ppt

Ngày tải lên : 09/08/2014, 10:21
... 8:575-581 Touboul E, Schlienger M, Hadjrabia S, Laugier A: [Cancer of the anal canal; role of radiotherapy and combinations of chemotherapy and radiotherapy] Rev Med Interne 1993, 14:340-349 Akbari RP, ... was stopped after first cycle of chemotherapy at a dose of 43 Gy because of toxicity and old age of the patient The intensity of chemotherapy was reduced in smoker and non-smokers due to hematologic ... difference between the three treatment protocols On the other hand only 10 patients were treated outside the RTOG protocol and the differences between the three protocols in dose and chemotherapy are...
  • 7
  • 393
  • 0
báo cáo khoa học: "Magnitude of risks and benefits of the addition of bevacizumab to chemotherapy for advanced breast cancer patients: Meta-regression analysis of randomized trials" ppt

báo cáo khoa học: "Magnitude of risks and benefits of the addition of bevacizumab to chemotherapy for advanced breast cancer patients: Meta-regression analysis of randomized trials" ppt

Ngày tải lên : 10/08/2014, 10:21
... in context with the other exploring the safetyefficacy balance of the addition of bevacizumab to chemotherapy for advanced breast cancer strengthen the need of a deep analysis of the correlation ... This amount of benefit well compares with the benefits of other important therapeutic choices such as the addition of taxanes for the st line treatment of metastatic breast cancer, where the advantage ... Magnitude of risks and benefits of the addition of bevacizumab to chemotherapy for advanced breast cancer patients: Meta-regression analysis of randomized trials Journal of Experimental & Clinical Cancer...
  • 9
  • 451
  • 0
Báo cáo y học: "The significance of glucose, insulin and potassium for immunology and oncology: a new model of immunity" ppt

Báo cáo y học: "The significance of glucose, insulin and potassium for immunology and oncology: a new model of immunity" ppt

Ngày tải lên : 11/08/2014, 10:23
... proposed that the effect of high levels of cortisol and of insulin in the blood at the time of the second challenge is that the clone of lymphocytes that would Page of 12 (page number not for citation ... duration of treatment and method of administration, but one of the advantages of GIK is that it is not a new drug Clinicians are familiar with the signs of toxicity and counter-measures The work of ... may prove helpful in the treatment of AIDS Page 10 of 12 (page number not for citation purposes) Journal of Immune Based Therapies and Vaccines 2005, 3:5 The significance of the mounting evidence...
  • 12
  • 430
  • 0
Báo cáo sinh học: " The significance of controlled conditions in lentiviral vector titration and in the use of multiplicity of infection (MOI) for predicting gene transfer events" pot

Báo cáo sinh học: " The significance of controlled conditions in lentiviral vector titration and in the use of multiplicity of infection (MOI) for predicting gene transfer events" pot

Ngày tải lên : 14/08/2014, 19:22
... volume of 0.1 ml) to 1.5 mm for the 0.3 ml volume, and a depth of 5.0 mm for ml of the vector preparation All of these depths were well beyond the diffusion limit of relevance to the adsorption of ... is the concentration of active virus at time t, VAO is the initial concentration of active virus, and Kd is the virus decay rate constant}, the half-life of the vector was in the 8–9 hr range The ... calculated using the number of TU/ml times the dilution factor of the vector stock, divided by the volume of vector used in the transduction As shown in the above results, the number of positively...
  • 10
  • 313
  • 0
Exploration of the functional significance of mig 2 in human cancer cell susceptibility to cytotoxic agents and cell growth control a pilot study

Exploration of the functional significance of mig 2 in human cancer cell susceptibility to cytotoxic agents and cell growth control a pilot study

Ngày tải lên : 05/10/2015, 22:15
... interest in cancer chemotherapy program and a large scale of screening program for the discovery of new anticancer drugs Nowadays, there are approximately 60 drugs available for the treatment of various ... knowledge of the regulation of growth and death in cancer cells has expanded enormously This leads to a better understanding of how these chemotherapeutic agents work and change the face of drug ... PE and centrifuge for 30-60 sec Discard the flow-through and centrifuge again for Transfer the column to a new 1.5-ml microfuge tube and add 50 µl of Buffer EB to the center of the column Stand...
  • 123
  • 257
  • 0
Techniques for developing content reading skills for the third year students at the university of odonto and stomatology

Techniques for developing content reading skills for the third year students at the university of odonto and stomatology

Ngày tải lên : 07/11/2012, 14:50
... in their mid-term and final exams for scholarship one hand and not re-taking the exams on the other hand Furthermore, the University of Odonto and Stomatology has been now co-operating with other ... true to the content field which forces learners to train themselves more outside the classroom to update them and meet the demand of their work Being aware of the great importance of ESP in the teaching ... terminologies to their foremost priority whereas 20% of the teachers and 19% of the students pay attention to meanings of the texts Grammar draws focuses from 20% of the teachers and 14% of the students...
  • 49
  • 1.2K
  • 2
Changes of temperature data for energy studies over time and their impact on energy consumption and CO2 emissions. The case of Athens and Thessaloniki – Greece

Changes of temperature data for energy studies over time and their impact on energy consumption and CO2 emissions. The case of Athens and Thessaloniki – Greece

Ngày tải lên : 05/09/2013, 16:10
... meteorological stations of the National Observatory of Athens (NOA) [8] and of the Aristotle University of Thessaloniki (AUTh) [9] The results for the two decades are compared and the existing differences ... contrary, for the cooling period of the 1993-2002 decade, an increase of the energy demands of the building for both cities is observed compared to the 1983-1992 decade For Athens the increase ... trend in the eastern and south-eastern parts of the Mediterranean, indicating a less frequent expansion of the low pressure over the area and therefore a weakening of the Etesian winds and a subsequent...
  • 14
  • 548
  • 0
TECHNIQUES FOR DEVELOPING CONTENT READING SKILLS FOR THE THIRD YEAR STUDENTS AT THE UNIVERSITY OF ODONTO AND STOMATOLOGY

TECHNIQUES FOR DEVELOPING CONTENT READING SKILLS FOR THE THIRD YEAR STUDENTS AT THE UNIVERSITY OF ODONTO AND STOMATOLOGY

Ngày tải lên : 07/09/2013, 13:45
... in their mid-term and final exams for scholarship one hand and not re-taking the exams on the other hand Furthermore, the University of Odonto and Stomatology has been now co-operating with other ... true to the content field which forces learners to train themselves more outside the classroom to update them and meet the demand of their work Being aware of the great importance of ESP in the teaching ... during the reading process, readers on the way to discover what the author means and to build meaning for themselves at the same time in their own language, their thoughts, and their own view of the...
  • 24
  • 789
  • 0
Intrathecal baclofen for the control of spinal and supraspinal spasticity

Intrathecal baclofen for the control of spinal and supraspinal spasticity

Ngày tải lên : 01/11/2013, 10:20
... implanted for the relief of severe lower limb spasticity and flexor spasms The goals then are improved comfort and wheelchair posture, Intrathecal baclofen for the control of spinal and supraspinal ... the process of consideration for ITB Patients may hear about ITB and discuss the question with their therapists rather than their doctors The charting of range and function before and after a ... cord than in the brain because of the characteristics of the circulation of the CSF from the ventricles to the spinal subarachnoid space The effective distribution volume of intrathecally administered...
  • 12
  • 578
  • 0