the selection sentence here top is put in a substring and displayed in the dynamic text field below the button bottom
Báo cáo y học: "Collagen-induced arthritis in C57BL/6 mice is associated with a robust and sustained T-cell response to type II collagen" pot
Ngày tải lên :
09/08/2014, 10:21
... swelling and a more gradual increase in clinical score Histological assessment of the hind paws from arthritic DBA/1 and B6 mice revealed that, in early arthritis (up to weeks after onset), there ... mice, the infiltrating cells were predominantly mononuclear in early arthritis and there was less joint erosion (c) In late arthritis, the inflammatory response largely resolved in DBA/1 mice, although ... (anti-TNF mAb), a disease-modifying anti-rheumatic drug (methotrexate), and a nonsteroidal anti-inflammatory drug (indomethacin) Clinical score was assessed, as a measure of spread of disease progression...
- 8
- 372
- 0
Báo cáo y học: "Early rheumatoid arthritis is characterized by a distinct and transient synovial fluid cytokine profile of T cell and stromal cell origin" pptx
Ngày tải lên :
09/08/2014, 06:22
... analyzed and interpreted the data, and drafted the manuscript FF performed the statistical analysis and was involved in drafting the manuscript SJC acquired the cytokine and chemokine data, analyzed ... data, analyzed and interpreted the data, and was involved in drafting the manuscript ET acquired the cytokine and chemokine data CYL participated in assessing patients and in performing ultrasound ... guided joint aspirations ANA, JML, CG and CB participated in the design of the study and interpretation of data MS participated in the design of the study and interpretation of data, and was involved...
- 12
- 460
- 0
How group work is used in speaking lesson of the first year major students of english at viet nam university of commerce
Ngày tải lên :
07/11/2012, 14:50
... equate being able to speak a language to knowing the language Therefore, they view learning the language as learning how to speak the language According to Nunan (1991), success is measured in ... great emphasis on four skills including listening, speaking, reading and writing and other subjects related to English theoretical linguistics The total time allocation and the training curriculum ... interviewing, discussing, and problem solving and decision-making because they were afraid of making noise In fact, I want to create a funny and interesting atmosphere for students by using games activity...
- 42
- 1.9K
- 4
Tài liệu Selecting the Top n Rows in a DataTable doc
Ngày tải lên :
14/12/2013, 18:16
... comparisons in the filter expression At this point, we are done unless there can be more than one instance of the value in the nth record, as is the case with Freight In this case, iterate over the ... Orders table SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable dt = new DataTable(ORDERS_TABLE); da.Fill(dt); da.FillSchema(dt, ... value for the nth record and set the DataView filter to contain only rows with a Freight value greater than or equal to that value Add the appropriate delimiters when making non-numeric comparisons...
- 4
- 332
- 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
Ngày tải lên :
16/02/2014, 09:20
... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... SJS170 ALS030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298...
- 14
- 635
- 0
Tài liệu The top ten algorithms in data mining docx
Ngày tải lên :
17/02/2014, 01:20
... continuous-valued), and Windy (binary), and the class is the Boolean PlayGolf? class variable All of the data in Figure 1.1 constitutes “training data,” so that the intent is to learn a mapping using this dataset ... combinatorial strategy for handling missing values For the first issue of evaluating decision tree criteria based on an attribute a, we can: (I) ignore cases in the training data that have a missing ... methods have become a mainstay in the machine learning and data mining literature Bagging and boosting (see Chapter 7) are popular choices Bagging is based on random resampling, with replacement,...
- 206
- 947
- 1
Tài liệu Internet in China: Big Mama is Watching You - Internet Control and the Chinese Government doc
Ngày tải lên :
18/02/2014, 00:20
... This is an issue that becomes paramount with the increasing capacities of databases The possibility of linking databases will certainly appeal to the central government, and this is exactly what ... to anyone interested.54 Propaganda The internet, in its function as media, is seen as an important playing ground for propaganda The Internet Propaganda Administrative Bureau, responsible amongst ... 14 Internet in China: Big Mama is Watching You The Internet in China This chapter will provide information about the origin and history of the internet in China First, we will take a look at the...
- 63
- 607
- 0
Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx
Ngày tải lên :
20/02/2014, 01:20
... 5¢-AGGCCCCGGGTCACCTC CTAGCTAGAATTC-3¢ for a1 ; and 5¢-AGGTGATC ATATGCTTCTAGAGAAGAGTGAAATA-3¢ and 5¢-AG AGGATCCTCAGCCCATTTGGAGGGCGG-3¢ for b1 In each case, the forward primer introduced a unique NdeI ... kDa), catalase (232 kDa), aldolase (158 kDa), albumin (67 kDa) and ribonuclease A (13.7 kDa) serving as molecular standards (Amersham Bioscience) Analysis of the N-terminal amino-acid sequences The ... family have similar structures consisting of two domains, one that binds FMN and one that binds FAD and NADPH [8–10] The FMN domain is homologous to flavodoxins, while the FAD and NADPH domain is homologous...
- 11
- 549
- 0
Tài liệu Báo cáo khoa học: Gene transcription of fgl2 in endothelial cells is controlled by Ets-1 and Oct-1 and requires the presence of both Sp1 and Sp3 pdf
Ngày tải lên :
20/02/2014, 11:20
... Arrows indicate the bands that are interacting with these probes All the lanes have labelled probes The adding of extracts and cold probe are indicated in the top of the panel Supershift, ss-Sp1 and ... TAC CGC ATC ACA GTC TC GCA AAT GCG CCA GGT ACC TTC TGG GAA CTC GAG TTC CCA GAA GGT ACC TGG CGC ATT TGC CCG CCC TTT TGA GGT ACC AGA GAA CGC CTG CAG GCG TTC TCT GGT ACC TCA AAA GGG CGG CTG GGA ACT ... GGGGCGGGGCGAGC-3¢; Ets/Pea3, 5¢-GATCTCGAG CAGGAAGTTCGA-3¢; Ets (PU.1), 5¢-GGGCTGCTTG AGGAAGTATAAGAAT-3¢; Stat3, 5¢-GATCCTTCTG GGAATTCCTAGATC-3¢; and C/EBP, 5¢-TGCAGATT GGGCAATCTGCA-3¢ are from Santa Cruz Biotechnology...
- 13
- 525
- 0
Tài liệu Báo cáo khoa học: "THERE STILL IS GOLD IN THE DATABASE MINE" potx
Ngày tải lên :
21/02/2014, 20:20
... language? If able to generate language as well as to understand it, a database assistant could carry on a natural conversation with the user Generating language An intelligent database interface ... relational, database to one that changes in real time, contains large amounts of textual data, or is more of a knowledge base than a data base, one can manipulate the kind of language that a user ... Research ~ All of this is not to say that all the research problems in computational linguistics can be carried on even in the extended context of database access It is rather a plea for careful...
- 2
- 432
- 0
Báo cáo khoa học: The autophagic response to nutrient deprivation in the hl-1 cardiac myocyte is modulated by Bcl-2 and sarco⁄endoplasmic reticulum calcium stores ppt
Ngày tải lên :
07/03/2014, 09:20
... Brady et al degradation of the autophagosomes and cargo by lysosomal proteases [2,3] The autophagic pathway is crucial for maintaining cell homeostasis and disruption to the pathway can be a ... Beclin contains a Bcl-2-binding domain which may serve as a point of cross-talk between the autophagic and apoptotic pathways Recently, a BH3 domain in the Bcl-2-binding domain of Beclin was shown ... numerous autophagosomes in the absence of lysosomal inhibitors (steady-state) An increase in steady-state autophagy without a corresponding increase in cumulative autophagy would indicate a defect in...
- 14
- 444
- 0
Báo cáo khoa học: The Y42H mutation in medium-chain acyl-CoA dehydrogenase, which is prevalent in babies identified by MS/MS-based newborn screening, is temperature sensitiv pptx
Ngày tải lên :
07/03/2014, 16:20
... investigated, to distinguish between a ÔbenignÕ MCAD variant that causes an abnormal acylcarnitine pattern, but is unlikely to cause disease, and a ÔdiseasecausingÕ MCAD variant Therefore we have in the present ... MCAD protein was measured by native (A) and denaturing (B) PAGE in combination with Western blotting The blot was also secondarily stained for ETF, showing the a and b subunits, as a loading control ... scan of each sample using the same cell as that used for the sample and under the same conditions (specifically temperature) Both the baselines and protein scans were made in duplicate and the...
- 11
- 429
- 0
Báo cáo Y học: The plant S-adenosyl-L-methionine:Mg-protoporphyrin IX methyltransferase is located in both envelope and thylakoid chloroplast membranes pot
Ngày tải lên :
08/03/2014, 16:20
... presenting a high alignment score with the Synechocystis protein [27], in A thaliana (CAB36750), in Oryza sativa (BAA84812) and in Nicotiana tabacum (AF213968) genomes The resulting putative plant ... amino acids of each sequence according to [31] Distance is indicated in PAM (probability of accepted mutation) The plant proteins appear very close to each other and as well as to the cyanobacterial ... either the plasmid containing the inverted insert or containing soMGD1 cDNA, a control cDNA encoding a MGDG synthase from spinach (Fig 2A, B) These results demonstrate that the characterized Arabidopsis...
- 9
- 568
- 0
Processing Fluency and Aesthetic Pleasure: Is Beauty in the Perceiver''''s Processing Experience? pptx
Ngày tải lên :
16/03/2014, 18:20
... Newell and Bright (2001) presented grammatical letter strings in an encoding phase and then assessed grammaticality and liking ratings for both grammatical and ungrammatical items at test In all ... grammatical letter strings In a subsequent test phase, participants received novel grammatical and ungrammatical strings and indicated their liking for these strings As predicted, grammatical ... removed at random until the participant could identify the letter string Participants reacted faster to grammatical rather than ungrammatical letter strings, indicating that grammatical letter strings...
- 20
- 514
- 0
Báo cáo khoa học: Oxidative stress is involved in the permeabilization of the inner membrane of brain mitochondria exposed to hypoxia/reoxygenation and low micromolar Ca2+ Lorenz Schild1 and Georg Reiser2 doc
Ngày tải lên :
16/03/2014, 22:20
... mitochondria allow investigation of the impact of single factors and their interplay, such as Ca2+ and ROS Therefore, we exposed isolated rat brain mitochondria to H ⁄ R and ⁄ or Ca2+ and determined ... combination of both After each treatment, mm glutamate, mm malate, and 200 lm ADP were added to the incubation to induce state respiration and oxygen consumption was analysed The corresponding values ... Preparation and incubation of brain mitochondria This work was conducted in accordance with the regulations of the National Act, the use of Experimental Animals (Germany) Mitochondria were prepared...
- 9
- 433
- 0
Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells potx
Ngày tải lên :
16/03/2014, 23:20
... proteases, such as carboxypeptidase Y in yeast, subtilisin, a- lytic protease, and aqualysin in bacteria (reviewed in [26]) When a histidine tag was fused with the prosemin catalytic domain using the ... serine protease family, testisin and prostasin, are also expressed in ovarian carcinomas [31,32] Immunohistochemical analysis demonstrated the expression of prosemin in clinical ovarian carcinomas, ... sequence was amplified from human pancreatic cDNA using the primer set (forward, CCCA AGCTTACCATGAATCTACTCCTGAT; reverse, GTTG GTACCTTGTCATCATCATCAAAGG), and inserted into the pcDNA3 vector (Invitrogen)...
- 13
- 483
- 0
Neither of the children is interested in learning pptx
Ngày tải lên :
20/03/2014, 00:20
... chung; danh từ số nhiều “child” – đ a bé, đ a trẻ - Cách chia động từ: Sau “neither of ” động từ chia số hay số nhiều Ví dụ: “Neither of the children is (are) interested in learning” Không đ a bọn ... *Neither of the children is interested in learning • Hình thức cấu trúc ngữ pháp: Neither of + the/ these/ those…/ my/ your/ his … + N (số nhiều)” – không (trong hai cái), không người (trong hai ... tích - “Neither of the children” - không đ a bọn trẻ - is interested in learning” – thích học Cấu trúc từ “to be interested in + Ving” = “to be fond of + V-ing” = “to be keen on + Ving” – thích,...
- 5
- 376
- 0