the role of clusterin a sensitive cellular biosensor of free radicals
Tài liệu Báo cáo khoa học: The small heat shock proteins and their role in human disease pptx
Ngày tải lên :
19/02/2014, 18:20
... a- crystallin deamidation involves the nonenzymatic conversion of asparagine to either aspartate or isoaspartate, and glutamine becomes glutamic acid, prevalent changes during cataract formation and aging ... development of therapeutic applications such as the use of carnosine to disaggregate glycated a- crystallin [47] and employing agents that prevent post-translational changes [40] Cataract and a- crystallin ... human aA-crystallin from normal aged and cataractous lenses Biochim Biophys Acta 1549, 179–187 Shridas P, Sharma Y & Balasubramanian D (2001) Transglutaminase-mediated cross-linking of a- crystallin:...
- 15
- 573
- 0
Báo cáo khoa học: Functional similarities between the small heat shock proteins Mycobacterium tuberculosis HSP 16.3 and human aB-crystallin docx
Ngày tải lên :
23/03/2014, 21:21
... 10 The sample was then centrifuged at 35 000 g for h at °C The supernatant was decanted and the insoluble pellet was discarded The supernatant was then ready for purification using the Pharmacia ... human aB-crystallin after a 30-min period The bar graphs measure the aggregation of CS in arbitrary units vs the ratios of MTB HSP 16.3/CS and human aB-crystallin/CS With increased ratios of the ... period The aggregation of CS was measured with the addition of different concentrations of MTB HSP 16.3 and in the presence or absence of ATP and ATP analogs (A) Aggregation of CS is plotted in arbitrary...
- 8
- 310
- 0
Tài liệu Báo cáo khoa học: Interaction of the small heat shock protein with molecular mass 25 kDa (hsp25) with actin doc
Ngày tải lên :
20/02/2014, 23:20
... in the appearance of an additional peak at 7.65 mL on the elution profile Increase of the temperature of incubation was accompanied by the simultaneous increase of the peak eluted at 7.65 mL and ... plotted against the total quantity of actin in the sample Results Heat denaturation of actin Before starting the investigation of the HSP25–actin interaction it was desirable to characterize the ... mutant of HSP25 on the initial rate of actin polymerization can be explained by the prevention of nonspecific aggregation of partially denatured actin that can trap intact actin The 3D mutant...
- 10
- 431
- 0
Báo cáo khóa học: Chaperone activity of cytosolic small heat shock proteins from wheat pptx
Ngày tải lên :
07/03/2014, 15:20
... than TaHsp16.9C-I, or has a more nonglobular shape Finite element analysis of the data [28] estimates a molecular mass of 201 kDa for TaHsp16.9C-I and 173 kDa for TaHsp17.8C-II These data are consistent ... that there is always a free peak of sHsp on SEC, even when some of the substrate has precipitated The free sHsps could still have a role in protection, by cycling on and off the aggregates, as ... luciferase reactivation assays Luc was heat-inactivated at 42 °C in the presence of sHsp as described for formation of sHsp/Luc complexes above Luc reactivation in reticulocyte lysate was assayed as...
- 11
- 386
- 0
Báo cáo khoa học: Temperature and concentration-controlled dynamics of rhizobial small heat shock proteins doc
Ngày tải lên :
23/03/2014, 12:20
... T., Sasamoto, S., Watanabe, A. , Idesawa, K., Iriguchi, M., Kawashima, K., Kohara, M., Matsumoto, M., Shimpo, S., Tsuruoka, H., Wada, T., Yamada, M & Tabata, S (2002) Complete genomic sequence of ... significant increase of the void volume fraction and a decrease of dimeric CS and the second HspH peak (Fig 7A, broken line), indicative of the formation of large and stable chaperone–substrate Ó FEBS ... at 25 °C (B) Thermal aggregation of citrate synthase (CS) at 43 °C in the presence of different concentrations of HspB or HspB(G11 6A) was recorded at 360 nm The CS assay was performed in the absence...
- 10
- 289
- 0
Báo cáo khoa học: Mimicking phosphorylation of the small heat-shock protein aB-crystallin recruits the F-box protein FBX4 to nuclear SC35 speckles docx
Ngày tải lên :
23/03/2014, 13:20
... ethanol or an a1 -adrenergic antagonist J Biochem (Tokyo) 117, 1238–1243 Kato, K., Goto, S., Inaguma, Y., Hasegawa, K., Morishita, R & Asano, T (1994) Purification and characterization of a 20-kDa ... mutation in the aB-crystallin chaperone gene causes a desmin-related myopathy Nat Genet 20, 92–95 Sawada, K., Agata, K., Yoshiki, A & Eguchi, G (1993) A set of anti-crystallin monoclonal antibodies ... has only been demonstrated unambiguously in the case of the pseudophosphorylated mutants, stained with the anti-(aB-crystallin) mAbs, and in the case of endogenously phosphorylated aB-crystallin,...
- 9
- 381
- 0
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx
Ngày tải lên :
07/03/2014, 04:20
... 5¢-CAAATTGGGGG CCCAGCAGCTGGGAAGTCTGAA-3¢ and 5¢-TTCAGA CTTCCCAGCTGCTGGGCCCCCAATTTG-3¢ for E19 9A, and 5¢-GAAGCTGGGAAGTCTGCACAGTCTGGAGCC AAG-3¢ and 5¢-CTTGGCTCCAGACTGTGCAGACTTCC CAGCTTC-3¢ for E20 4A ... 5¢-TTCGA GGCCCGCGCCGCAATTGGGGGCCCAGAA-3¢ and 5¢TTCTGGGCCCCCAATTGCGGCGCGGGCCTCGAA-3¢ for E19 0A, 5¢-ATTCCGGTTACTTTCGCGGCCCGCGC CCAAATT-3¢ and 5¢-AATTTGGGCGCGGGCCGCGA AAGTAACCGGAAT-3¢ for E19 0A, 5¢-CAAATTGGGGG ... Q19 4A, was also prepared and included as a control The role of the C-terminal extension and each of the mutated residues was investigated by comparison of the structure and function of these mutants...
- 14
- 417
- 0
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf
Ngày tải lên :
07/03/2014, 12:20
... 5¢-GGACACGTACAAGGAGAATTTCGACGACG-3¢ 5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3¢ 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢ 5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢ 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢ 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ ... oxygen This is arguably the ultimate indifference to anoxia of any metazoan [42], and qualifies the organism, as other of its characteristics, as an extremophile Because activated Artemia embryos resume ... heat-induced inactivation better than mutated p26, and at 1200 nm the activity remaining was essentially the same as in unheated preparations (Fig 5D) R11 4A was the least effective of all p26 variants...
- 15
- 515
- 0
Báo cáo khoa học: Effect of mutations in the b5–b7 loop on the structure and properties of human small heat shock protein HSP22 (HspB8, H11) pptx
Ngày tải lên :
23/03/2014, 07:20
... electrophoresis [31] as a band with an apparent molecular mass of 25.4 kDa, whereas the apparent molecular mass of the double mutant K137,141E was 30.4 kDa The calculated molecular mass of human wild-type ... mutations of the b5–b7 loop of human HSP22 A S Kasakov et al A B Fig Comparison of the structure of human HSP22 and other sHsp (A) Ribbon diagram of T aestivum Hsp16.9 monomer (protein databank ... kDa to 29.3 kDa A similar decrease in the apparent molecular mass was observed for the K137,141E mutant of HSP22; however, at all concentrations, the apparent molecular mass of this mutant was...
- 15
- 431
- 0
Tài liệu Báo cáo khoa học: Regulation of the members of the mammalian heat shock factor family doc
Ngày tải lên :
18/02/2014, 04:20
... subunit of the Cul3-RING ubiquitin ligase Cell Stress Chaperones 15, 301–308 Kawazoe Y, Nakai A, Tanabe M & Nagata K (1998) Proteasome inhibition leads to the activation of all members of the heat-shock-factor ... to repress the transactivation capacity of HSF1 [52–57] Another post-translational modification, suggested to affect HSF1 activity, is the stress-inducible covalent attachment of the Small Ubiquitin-like ... multiple steps in the pathway from DNA to RNA to protein, such as control of transcription and mRNA stability, and the relative rate of protein synthesis and degradation Moreover, the mechanisms by which...
- 14
- 549
- 0
Tài liệu Báo cáo khoa học: Analysis of oxidative events induced by expanded polyglutamine huntingtin exon 1 that are differentially restored by expression of heat shock proteins or treatment with an antioxidant ppt
Ngày tải lên :
19/02/2014, 06:20
... greater than · 101 was recorded during the FACS analysis The percentage of decrease of DYm was calculated as the ratio of the percentage of cells with FL2-H fluorescence greater than · 101 in the ... represent a problem that the cell has to challenge to promote the formation and clearance of these bodies Aggregate clearance could therefore be balanced between the rate of huntingtin aggregation and ... Japan) Images were recorded with a MegaviewII numeric camera, and analysis software (Soft Imaging System GmbH, Munster, Germany) ¨ was used to analyze the images Determination of intracellular...
- 18
- 721
- 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
Ngày tải lên :
22/02/2014, 04:20
... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 ... significance of a small heat shock /a- crystallin protein (p26) in encysted embryos of the brine shrimp, Artemia franciscana Am Zool 39, 836–847 Liang, P & MacRae, T.H (1999) The synthesis of a small heat...
- 10
- 495
- 0
Báo cáo khóa học: Some properties of human small heat shock protein Hsp20 (HspB6) potx
Ngày tải lên :
07/03/2014, 15:20
... or greater than that of commercial a- crystallin At pH 7.0, the heating of isolated ADH in the absence of divalent cations was accompanied by aggregation and a large increase in the light scattering ... an increase of the lag period and a decrease in the amplitude of light scattering Significant retardation of the insulin B-chain aggregation was observed at an insulin/Hsp20 ratio of : At a mass ... was accompanied by a significant decrease of molecular mass The molecular mass of a- crystallin that was not subjected to urea treatment was > 900 kDa, whereas after urea treatment and renaturation...
- 12
- 372
- 0
Báo cáo khoa học: Small heat shock protein Hsp27 prevents heat-induced aggregation of F-actin by forming soluble complexes with denatured actin docx
Ngày tải lên :
16/03/2014, 06:20
... for native actin filaments or actin aggregates formed upon thermal denaturation of F-actin in the absence of Hsp27-3D Analytical ultracentrifugation of the Hsp27-3D complexes with denatured actin ... on the sedimentation behavior of Hsp27-3D Increasing Hsp27-3D concentration in the sample increases the amplitude of the peak at 3.2 S (Fig 4A C), and this indicates that the amount of actin -free ... (Varian Australia Pty Ltd, Mulgrave, Victoria, Australia) equipped with a temperature controller and thermoprobes F-actin in the absence or in the presence of Hsp27-3D was heated at a constant...
- 12
- 319
- 0
Báo cáo khoa học: Characterization of novel sequence motifs within N- and C-terminal extensions of p26, a small heat shock protein from Artemia franciscana potx
Ngày tải lên :
30/03/2014, 20:20
... G 5¢-GGCACTTAACCCATGGTACATGGACCTTGATATTGAC-3¢ 5¢-GTCAATATCAAGGTCCATGTACCATGGGTTAAGTGCC-3¢ 5¢-GGACCTTGATATTGACGGTCCAGATACC-3¢ 5¢-GGTATCTGGACCGTCAATATCAAGGTCC-3¢ 5¢-GGATTGAAGGGGGAAGATCAGGAGGTGC-3¢ ... sHSPs The amino acid sequences of selected sHSPs were analyzed by CLUSTAL W (1.82) Ap26, A franciscana p26, AAB87967; HCRYAA, Homo sapiens aA-crystallin, P04289; HCRYAB, H sapiens aB-crystallin, ... top of each gradient is to the right and fractions are numbered across the top The molecular mass markers, a- lactalbumin, 14.2 kDa; carbonic anhydrase, 29 kDa; bovine serum albumin, 66 kDa; alcohol...
- 14
- 358
- 0
Báo cáo Y học: A critical motif for oligomerization and chaperone activity of bacterial a-heat shock proteins pot
Ngày tải lên :
31/03/2014, 21:21
... mammalian a- crystallins, the oligomerization principles of bacterial a- Hsp proteins have received little attention Available data indicate that a- Hsp proteins from prokaryotes and plants may differ ... multimerization-incompetent a- Hsp proteins have poor or lacking chaperone activity [24,25,42] The chaperone activity of mammalian a- crystallins, on the other hand, appears to be much more resistant against ... incubated at 43 °C in a total volume of 1.0 mL of 50 mM phosphate buffer, pH 6.9 CS aggregation was measured by the increase of absorbance at 360 nm in the absence (r) and in the presence of a- Hsp...
- 9
- 467
- 0
báo cáo khoa học: "Heat-shock proteins in infection-mediated inflammation-induced tumorigenesis" potx
Ngày tải lên :
10/08/2014, 22:20
... peptide associated with heat-shock protein gp96 Lancet 2001, 357:528-529 Harimoto N, Shimada M, Aishima S, Kitagawa D, Itoh S, Tsujita E, Maehara S, Taketomi A, Tanaka S, Shirabe K, Maehara Y: The role ... in the urinary bladder of schistosomal patients may enhance the carcinogenic potential of these agents by increasing their rate of activation Furthermore, in patients with S haematobium and bladder ... reactivity of these radicals with GSH, DNA, and unsaturated lipid Free Radic Biol Med 1988, 4:169-183 Maresca B, Carratu L: The biology of the heat shock response in parasites Parasitol Today...
- 10
- 587
- 1
Local induction of heat shock proteins using magnetic fluid hyperthermia for ocular neuroprotection in glaucoma
Ngày tải lên :
09/09/2015, 10:08
... superficial and interstitial hyperthermia (a) Superficial microwave hyperthermia of malignant melanoma of the skin, (b) interstitial hyperthermia in a radical treatment of right breast cancer An example ... Yamada, Minhong Jeun, Seongtae Bae and Yasushi Takemura, “Magnetic Characterization and Self-Heating of Various Magnetic Nanoparticles for Medical Applications” The 3rd IEEE International NanoElectronics ... Seongtae Bae, and Yasushi Takemura, “Self-Heating Evaluation and Magnetic Property of Different Size Magnetic Nanoparticles” 2nd ISAMMA, Sendai, Japan, (2010, 07) Asahi Tomitaka, Hiroki Kobayashi,...
- 191
- 205
- 0
Immunomodulatory roles of heat shock proteins
Ngày tải lên :
09/10/2015, 11:06
... colleagues have made an important contribution to the discovery of the role of HSPs in cancer immunity, particularly in the processing and cross-presentation of antigen [Srivastava and Amato, ... similarity of the signaling pathway between lipopolysaccharide (LPS, a bacterial endotoxin) and HSPs [Akashi et al., 2003; Kawasaki et al., 2003; Lien et al., 2000], the concern for LPS contamination ... the supernatant was harvested The supernatant was then equilibrated with the Ni-NTA bead (QIAGEN, Hilden, Germany) overnight at °C The affinity column was packed and first washed with wash buffer...
- 152
- 547
- 0