the role of a security manager within different organizations
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
... Institute of BioAgricultural Sciences, Academia Sinica, Taipei, Taiwan, ROC2 Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC3 Department of Biochemistry, University of Minnesota College of ... structure-based analysis of staphylococcal nuclease. Proteins: Structure, Functionand Genetics 27, 171–183.15 Flanagan JM, Kataoka M, Fujisawa T & EngelmanDM (1993) Mutations can cause large changes ... reportedthat multiple mutations can cause large changes in the average conformation of denatured proteins. Here weshow that a specific single mutation or removal of a specific fragment can cause large...
- 7
- 551
- 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
... higher value almost 2.5-fold higher than the native cold adapted enzyme (Table 1). The mutantG26 1A/ Y26 9A exhibits an E a almost the same as in the caseofthenativeenzyme(Table1).Thermal inactivation ... gene encoding alkaline phosphatasefrom the Antarctic strain TAB5 [16]. Based on the crystalstructure (at 2.4 A ˚)ofanEscherichia coli alkaline phospha-tase variant with a 28% amino-acid sequence ... from the AntarcticTable 1. Enzymatic and thermodynamic parameters of the psychrophilic alkaline phosphatase and mutants. Reported values were determined at10 °C. The kcatvalues were calculated...
- 6
- 488
- 0
Tài liệu THE ROLE OF UNIVERSITIES IN REGIONAL INNOVATION SYSTEMS - A NORDIC PERSPECTIVE pdf
... of the transistor indicated a spiral model of interac- 50Since 1970, the State has funded both capital investments and the running of the University of Aarhus in the same way as for the other ... regionsmake it impossible to take advantage of the full growth potential of a univer-sity.Another hypothesis is that the size of the regional impact of a university pri-marily reflects the characteristics ... Ålborg and Roskilde, togetherwith the expansion of the number of students at the Aarhus School of Busi-ness in the 70s and the 80s, the rate of growth decreased and the number of students was maintained...
- 180
- 596
- 1
Tài liệu Organization-internal Transfer of Knowledge and the Role of Motivation: A Qualitative Case Study pptx
... control The way the knowledge transfer programme wasmanaged also differed between plants. The idea of the central programme management was that,at the least, plants should make yearly plans foreach ... (production manager) .Aspiration and strategic ambitionsBecause each plant investigated was run as a profitcentre and was normally measured (by corporateheadquarters) on operating margin and/or ... have. The role of motivation isprobably as important in a chain of hotels or super-markets, a software vendor or a consulting com-pany, regardless of the nature of knowledge. The method of analysis...
- 12
- 514
- 0
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx
... REPRESENTATIVESJohn B. Bass, Jr., M.D.American Thoracic SocietyUniversity of South AlabamaMobile, ALNancy E. Dunlap, M.D.American College of Chest PhysiciansUniversity of Alabama at BirminghamBirmingham, ... heterogeneity in the efficacy of the BCG vaccine reported in the individual studies. Using a model that included the geographic latitude of the study site and the data validity score as covariates, they ... Public Health VeterinariansKeith A. Clark, D.V.M., Ph.D.Texas Department of HealthAustin, TXNational Vaccine ProgramAnthony Robbins, M.D.Office of the Assistant Secretary forHealthWashington,...
- 27
- 1,309
- 3
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* WT* W11F ... mutationsMousumi Banerjee1, Hemalatha Balaram2and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India2 Molecular Biology and Genetics Unit, Jawaharlal ... inenzymes: a study of triosephosphate isomerase andcomparison with methyl glyoxalsynthase. Adv ProteinChem 66, 315–372.45 Gunasekaran K, Ramakrishnan C & Balaram P (1996)Disallowed Ramachandran...
- 15
- 635
- 0
Tài liệu Báo cáo khóa học: The effect of mutations surrounding and within the active site on the catalytic activity of ricin A chain pptx
... usingIMAGEQUANTsoftware, anddepurination was calculated by relating the amounts of the small aniline-fragment and 5.8S rRNA and expressingvalues as a percentage.Reassociation and quantification of ... quantitativeactivity assays of these RTA variants, was not achieved. Toassess whether substitution at Asn78 with Ser changed the catalytic activity of RTA, the N-glycosidase activity of RTAN78S against ... collection andrefinement statistics are given in Table 1.Assay of the N-glycosidase activity of ricin A chainvariants The activity of each of the RTA variants was determinedby assessing their ability...
- 10
- 616
- 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
... epitope tag was added t o the end of t he ESSS ORF. The forward primer was: 5Â-ACgaatccGATCTCCGACCCA-3Â; the reverse primer was:5Â-ATgctagcCTCATCTTCTGGTAACTGG-3Â. Small bo ldletters refer to the ... antibodieswere as follows: anti-porin from Calbiochem, anti-HA fromCovance BabCo, anti-mouse and anti-rabbit secondaryantibodies from Bio-Rad Laboratories and AmershamPharmacia Biotech, respectively. Antibodies ... analyses of the ESSS cDNA in these mutantsrevealed chain termination mutations. In two of thesemutants the protein i s truncated at the C-terminus of the targeting sequence; the m utants are...
- 9
- 622
- 0
Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf
... enterprises,as well as the actual constraints exerted by the structure of a balance sheet are still limited, a qualitative survey may actually offer a stronger appraisal of their actual behaviors.Section ... determinants of the probability of making profit, but this would be a set of given, ‘frozen’ parameters, rather thanadjustment variables on which the managers’ strategies would actually be able bear. ... would have to take into account the evolution of real wages as well as of wage arrears. However, a remarkable point is that a substantial proportion of firms (31.5% of the sub-sample) has increased...
- 30
- 635
- 0
TMJ Disorders and Orofacial Pain The Role of Dentistry in a Multidisciplinary Diagnostic Approach pptx
... (Nickel and McLachlan 1994). 38 Function and structural adaptation of the condyle Summary of the basic anatomical and functional changes in the condylar portion of the joint. Increased functional ... subchondral cartilage has not yet been affected and would appear in-tact on a radiograph. 35 Buildup of the condylar cartilage Histologically, the secondary cartilage of the condyle is made up of ... Neurovascular pain Vascular pain Glandular, ocular, and auricular pain Pulpaf pain Visceral mucosal pain Periodontal pain Connective-tissue pain Ostealgia m6 periosteal pain ...
- 379
- 1,162
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... glycosyl-transferase elucidate catalysis in the alpha-amylase family. Nat.Struct. Biol. 6, 432–436.16. Terwisscha van Scheltinga, A. C., Armand, S., Kalk, K.H., Isogai, A. , Henrissat, B. & Dijkstra, ... However, the mechanistic roles of several of these residues are not described well and there is no example of mutational analysis of all of these residues in the sameenzyme.To obtain an insight ... regard to the role of Asp140,whichappearstobecrucialinChiBandinchitinaseA1from Bacillus circulans, whereas it may be mutated toasparagine without loss of activity in other family 18chitinases...
- 10
- 651
- 0
MICROECONOMICSPrinciples and AnalysisFrank A. CowellSTICERD and Department of Economics London School of Economics December 2004.ii.ContentsContents List of Tables List of Figures Preface 1 Introduction 1.1 The rôle of microeconomic principles . potx
... in the analysis of game-theoretic models (chapter 10) –how one playerresponds to the actions of another on the assumption of a speci…c form of the rules of the game.We use the comparative statics ... equation:q = F(K; L) (“quantity of output = a function of capital and labour”), whichis a convenient way of picking up some of the features that are essential toanalysing the behaviour of the ... because the method of proofis not particularly illuminating or is rather technical. Throughout each chapter there are footnotes that focus on detailed points of the argument. These take the...
- 668
- 5,134
- 0
The role of pictures in improving health communication: A review of research on attention, comprehension, recall, and adherence doc
... imbalance, educationalimbalance, and where they are fearful of appearing stupidand fearful of rejection or abandonme nt. As a result, they arehesitant to admit that they do not understand ... literacy amongmedicare enrollees in a managed care organization. JAMA 1999;281:545–51.[10] International Reading Association, Special Interest group on readingand readability. Newark, Delaware, ... novelabout asbestos hazards or an NCI asbestos pamphlet weremailed, with an evaluation questionnaire, to a random sample of 500 members of a building trades union. There was a 21%response rate...
- 18
- 919
- 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf
... TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATTP74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTACReverse CATTTTGTCCGCCAAGACTTTTGAATACTT TCAAGTGCQ76G Forward CTTCCCGGAGGAAATGAGGACTTGGTACTTACTGReverse CCTCATTTCCTCCGGGAAGACTTTTGAATA ... Mutation Direction SequenceStandard All ForwardGCTCAGGCGACCATGGGCCATCATCATCReverse CTTGCATGCCCTGCAGGTCGMutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTGReverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATTP74G ... CCTCATTTCCTCCGGGAAGACTTTTGAATA CN77G Forward CGGACAAGGTGAGGACTTGGTACTTACTGGATACReverse CAAGTCCTCACCTTGTCCGGGAAGACTTTTGÓ FEBS 2002 Second protease-binding loop of cystatin A (Eur. J. Biochem....
- 10
- 533
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25