the rise and fall of the psychodynamic
Training and development of technical staff in the textile industry pptx
Ngày tải lên :
28/06/2014, 17:20
... interest and practice the tuning of the machines, they should be able to get the required quality and productivity The fear of failure or of spoiling the costly machines make the management think of ... management and the operators or workers working on the shop floor The technical staffs the work of understanding the top management requirements and policies and deploying them down the line The supervisor ... get the material in time The commercial people at purchasing cannot understand the importance of the items ordered, and they treat all as same, and for them the yardstick is the cost Once the...
- 301
- 417
- 0
báo cáo khoa học: "E-learning interventions are comparable to user’s manual in a randomized trial of training strategies for the AGREE II" pps
Ngày tải lên :
10/08/2014, 11:20
... contributions of the members of the AGREE A3 Team who have participated in the AGREE A3 Project The authors wish to acknowledge the contributions of Chad Large and Steve McNiven-Scott of the Division of ... (i.e., review of the PDF version of the AGREE II only) was very effective, and that there is a ceiling effect on performance measures and other outcomes Exploring these conclusions further, a significant ... new to the area of PGs and the AGREE II Enterprise The training interventions are available through the AGREE Enterprise Web site [26] Acknowledgements The authors wish to acknowledge the contributions...
- 10
- 438
- 0
The educational managemnt of professional ethics to the teacher students in teacher training colleges in the southeast regions
Ngày tải lên :
24/08/2015, 04:45
... Objectives and targets of the study 2.1 Objectives of the study The process of schooling students in the ethical profession in the colleges of education 2.2 Targets of the study -Measures of the educational ... 2009 by the Minister of Education and Training), and the request from the training objectives of the pedagogical colleges 1.2.5 The process of the foundation and development of PEP - Through the ... -Clarifying the notion of pedagogical ethical profession, the theory of the educational management for pedagogical students in the colleges, the significance of the educational management of ethical profession,...
- 28
- 298
- 0
DEVELOPMENT OF a BLUEPRINT FOR COMPUTER BASED TRAINING (CBT) IN THE USE OF ELECTRONIC CHART DISPLAY AND INFORMATION SYSTEMS (ECDIS)
Ngày tải lên :
09/05/2016, 16:54
... that the objectives of the IMO Model Course and the questions and exercises in the CBT package relate to the medium and higher levels of the taxonomy, viz application, analysis, synthesis and ... function tests verifying the validity of the chart data and to verify the proper functioning of the ECDIS display verify: - the proper functioning of the ECDIS display and the position-fixing system ... screens and multiple choice questions at the end of the section to verify the trainee’s understanding and knowledge of the subject PRINCIPAL TYPES OF ELECTRONIC CHART 0.75 HOURS Given that the CBT...
- 62
- 405
- 1
Seafood Supply Chain Quality Management: The Shrimp Supply Chain Quality Improvement Perspective of Seafood Companies in the Mekong Delta, Vietnam
Ngày tải lên :
23/04/2013, 09:34
... Faculty of Management and Organization, Centre for Development Studies (CDS), the Faculty of Economics of the University of Groningen in the Netherlands, and the School of Economics and Business ... of Vietnam and the South of Vietnam The structure of Vietnam’s SFC organization The supply chain quality management of interviewed SFCs The fish chain in the Netherlands The shrimp chain in the ... have never seen the light of the day without the unstinting support and encouragement of my promotors Professor J Wijngaard and Professor A.C Waszink from the Faculty of Management and Organization...
- 247
- 716
- 1
LINH DAM NEW TOWN - SOLUTION FOR THE HIGH-DENSITY DEVELOPMENT OF NEW SETTLEMENTS IN THE SOUTH-WEST OF HANOI
Ngày tải lên :
29/08/2013, 08:15
... greatly expanded to the west and southwest The spatial growth of Hanoi is limited by natural barriers, such as streams to the northeast and east, water bodies to the north, and wetland to the south ... hand, relieve the overburdened center while, on the other hand, re-configure densities in what is already one of the most densely populated rural areas in the world (the “rural” component of the ... originally wetland and agriculture, has became a modern New Town, combined to the “natural” landscape and green space, and created a motivation for the development of the southern gateway of Hanoi...
- 10
- 805
- 3
LINH DAM NEW TOWN - SOLUTION FOR THE HIGH-DENSITY DEVELOPMENT OF NEW SETTLEMENTS IN THE SOUTH-WEST OF HANOI
Ngày tải lên :
29/08/2013, 08:15
... đình nhà chủ, 57,14% nhóm bán hàng rong 68,57% nhóm làm việc chợ lao động thuê trọ theo ngày (đêm), lại thuê nhà theo tháng Có khoảng 22,86% nữ lao động tự phải sống nơi có điều kiện sinh hoạt không ... lao động giúp việc “hài lòng” với công việc tại, tỷ lệ so với hai nhóm lao động tương đối cao, theo họ công việc không vất vả quê, thu nhập nhiều lao động gia đình chủ quan tâm 3.1.5 Định hướng ... họ tham gia vào đội ngũ lao động tự Họ phải làm công việc nặng nhọc với mức thu nhập thấp, kéo theo điều kiện sống mức tối thiểu, tạm bợ khu nhà trọ rẻ tiền với điều kiện sinh hoạt an ninh không...
- 8
- 654
- 0
Genotoxicity of 255 chemicals in the Salmonella microsome test (Ames test) and 8-hydroxyguanine (8-OH-Gua) assay for the detection of carcinogens
Ngày tải lên :
05/09/2013, 08:40
... supported by the research project The research on the development of the total evaluation technique for the hazardous impacts by the chemical substances towards human and ecology (the project ... P.P and Kadluber, F.F (1987) Identification of C8-modified deoxyinosine and N2- and C8-modified deoxyguanosine as major products of the in vivo reaction of N-hydroxy-6-aminochrysene with DNA and ... hydrocarbons and insecticides, but not suitable for that of herbicides, fumigants, heavy metals, inorganic chemicals and natural toxins, etc These results may suggest that the utility and limitations of...
- 6
- 735
- 0
EVALUATION OF HEALTH RISKS IN THE WASTEWATER RECLAMATION IN THE ABUKUMA WATERSHED, JAPAN
Ngày tải lên :
05/09/2013, 09:08
... Damage from the shortage of water The damage [%•day] from the shortage of water is quantified by the product of the percent of deficiency to the water supply demand [%] and the period of deficiency ... of health risks by the DALY What is DALY? The Disability-Adjusted Life Years (DALY) is the sum of the Years of Life Lost (YLL) and the Years Lived with a Disability (YLD) The YLL indicating the ... drinks L of water every day, the concentration in the drinking water should be lower than 0.25mg/L The cancer risk for chloroform is evaluated on the basis of the occurrence probability of the concentration...
- 11
- 506
- 0
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater
Ngày tải lên :
05/09/2013, 09:38
... reactor consisted of 45L of anoxic tank and 135L of aerobic tank, and a sedimentation tank Influent was 60L/day pH was 8.0-8.5 in the anoxic tank, and 7.0-7.5 in the aerobic tank The water temperature ... the laboratory of UT at 4oCstored Then, each of the samples were divided into two One of them was for DNA extraction and was washed with TE buffer at pH8.0, and stored at -20oC Another was for ... down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the...
- 8
- 572
- 0
Assessment of Mercury Contamination in the Kahayan River, Central Kalimantan, Indonesia
Ngày tải lên :
05/09/2013, 09:38
... 4oS and long 111oE, 116oE It is bounded to the northwest by the province of West Kalimantan, to the northeast by East Kalimantan, to the southeast by South Kalimantan, and to the southwest by the ... intake, and particularly the intake of M nemurus The reported annual rate of fish consumption in Central Kalimantan is the highest of all the provinces in Indonesia Hence there is a real risk of human ... Journal of Water and Environment Technology, Vol 6, No.2, 2008 The concentrations of mercury in the muscle tissues of the fish obtained from the two rivers did not differ from those in the muscle...
- 10
- 2K
- 1
Analysis of Phosphorus Behavior in the Giant Reed for Phytoremediation and the Biomass Production System
Ngày tải lên :
05/09/2013, 09:38
... the fluorescent lamp to the top of the giant reeds was about 0.2 m at the start of the experiment The temperature in the experimental room was kept at about 28 °C The rhizomes and the roots of ... cropped before the start of the dying down period Then, after all of the above-ground part has died down, the whole plants including the roots and rhizomes are cropped except for the roots and rhizomes ... based on the count of the beta ray, capture efficiency, device efficiency, and a specific value of the reagent The phosphorus accumulation was assumed to be uniform in all the leaves, and the total...
- 12
- 1K
- 0
The Importance of Eye Contact in the Classroom
Ngày tải lên :
06/09/2013, 10:10
... by training them to listen to each other using non-verbal responses only Research shows that there is a strong link between the amount of eye contact people receive and their degree of participation ... contact is, fundamentally, time and effort saving Much of the above is likely to seem transparently obvious, only natural, and an aspect of human behaviour either innate or developed over time ... group communication in the number of turns taken in a group conversation for example The NLP approach to eye contact is holistic and individualistic, but is soundly based on the premise that good...
- 2
- 698
- 0
A study on cultural obstacles to the teaching and learning of speaking skills in the classroom of grade 10 at nguyen tat thanh high school
Ngày tải lên :
07/09/2013, 13:00
... However, in the thesis, the researcher wants to find out the attitudes, as well as the cultural awareness in teaching and learning spoken English of the teachers and the students of 10 th grade ... overcome in the teaching and learning of speaking skills? I.5 Methods of the study To realize the aims of the study, both qualitative and quantitative methods will be used The data collected for the ... aware of the importance of cultural factors in the teaching of speaking skills and, too , aware of the great influence of inferences between two cultures- target and learner’s cultures- on these...
- 38
- 1.2K
- 0
A STUDY ON THE VIETNAMESE ENGLISH TRANSLATION OF EXHIBIT LABELS IN THE VIETNAM MUSEUM OF ETHNOGRAPHY
Ngày tải lên :
07/09/2013, 13:06
... prestige Another reason is the general convergence of thought, and sometimes of structure, among the European languages (such as the creation of the definite article, the concepts of culture and civilization) ... country of the world, museums have been open to help people understand and appreciate the natural world, the history of civilizations, and the record of humanity’s artistic, scientific, and technological ... II – THE TRANSLATION OF EXHIBIT LABELS IN THE VIETNAM MUSEUM OF ETHNOGRAPHY I THE CURRENT CONTEXT OF TRANSLATION OF EXHIBIT LABELS IN THE VIETNAM MUSEUM OF ETHNOGRAPHY The Vietnam Museum of Ethnography...
- 48
- 1.2K
- 3
Globalization: the Role of Institution Building in the Financial Sector _ The Case Study of China
Ngày tải lên :
18/10/2013, 07:15
... on supply and demand of funds in the rural areas and the risk of lending; the floating band for lending rate of urban financial institutions will be further expanded while control of general ... investors at the prices they offer through their outlets, and provide depositing and clearing services to the investors B Roles of the government and the central bank in bond market development The government ... negotiated price The trade of inter-bank bond market relies on the securities booking system of the CGSDTC and the bond trading system of the inter-bank lending centre The trading system of the national...
- 26
- 975
- 1
Compaction of disordered grains in the jamming limit - sand on random graphs
Ngày tải lên :
01/11/2013, 08:20
... with these low-lying, nearly degenerate ‘energy’ states On the other hand, there is only one way of covering the graph with the + + + state, which of course corresponds to the global minimum of the ... since there are many possible ways of using the mixed states − − +, − + −, + − − to cover the graph, which correspond to the various local minima on the ‘energy’ landscape of the system, there ... within the framework of mean-field theory, as well as the finite connectivity of the latter Interest in these models has intensified lately since they occur in the context of random combinatorial...
- 15
- 437
- 0
Tài liệu Action plan for the multi-level conservation of forest wetlands in the Mekong River Delta, Vietnam pdf
Ngày tải lên :
09/12/2013, 22:15
... of sustainable strategies in wetland conservation The inventories provide information on the type and the location of wetland, the economic and ecological value of the wetland, and the type and ... on the classification of forest wetlands, the inventory and mapping of wetlands, the mapping, and detailed description of the wetland’s diversity, and conducted applied research at regional and ... tide from the sea, yearly between 1.2 and 1.9 million hectares of land are inundated, mainly the Northern parts of the MD known as the LongXuyen quadrangle and the Plain of Reeds Along the 600...
- 8
- 688
- 0
Tài liệu Material Usage and Condition of Existing Bridges in the U.S pptx
Ngày tải lên :
20/12/2013, 20:15
... herein, and who will accept total responsibility for the application of this information The Portland Cement Association DISCLAIMS any and all RESPONSIBILITY and LIABILITY for the accuracy of the ... presented by the number of bridges and by the bridge deck area (i.e., product of structure length and width of bridge deck) Bridge deck area is more representative of the volume of construction, ... Inspection standards were issued in 1971 to satisfy this mandate of Congress Most states completed their inventory of bridges on the Federal-aid system by the end of 1973 In 1978, Congress passed the...
- 29
- 660
- 0