the recognition and manipulation of devices used to join sentences and form passages they are referred to as grammatical cohesion of a text
Báo cáo khoa học: "HOW TO DETECT GRAMMATICAL ERRORS IN A TEXT WITHOUT PARSING IT" doc
... LIKELIHOODS of tagpairs Instead of a separate tag-pair error likelihood table to assess the grammaticality, the same tag-pair frequency table is used for tag-assignment and error-detection The tag-pair ... that this approach was impractical because of the time and effort required to collect the necessary data In any case, an alternative technique which managed without a separate table of tag-pair ... tag-pair likelihood is a function of the frequency of that sequence of two tags in a sample of tagged text, compared to the frequency of each of the two tags individually An important advantage...
- 8
- 470
- 0
Ovarian cancer: the recognition and initial management of ovarian cancer doc
... management and treatment received Consequently national data on the management of ovarian cancer is sparse Some international data are available from GLOBOCAN and EUROCARE and are valuable for the ... report has highlighted the lack of data available to assess the burden of the disease based on the stage and the type of ovarian cancer It is clear that there are difficulties in the collection and ... care to assess the relationship between the duration of symptoms and ovarian cancer outcome 2.1 Awareness of symptoms and signs Early recognition of ovarian cancer symptoms Ovarian cancer has...
- 148
- 490
- 0
Testing Costs and Testing Capacity According to the REACH Requirements – Results of a Survey of Independent and Corporate GLP Laboratories in the EU and Switzerland potx
... bound and compared to our capacity figures very low We have summarized the average and maximum testing capacity in appendix The ratio of the maximum capacity to the average capacity available is about ... asked the labs to consider an estimation of the average and maximum number of tests based on the number of tests that they are able to conduct per year, as well as the number of tests they conducted ... be a share of 60% The data exploration has shown a considerable variability in the prices for single tests and the impact of three factors causing this variability The first factor that has caused...
- 19
- 493
- 1
The Future Isn’t What It Used To Be Changing Trends And Their Implications For Transport Planning doc
... considering factors such as the quality and price of available transport options Various factors can affect travel demands, as summarized below (Goodwin 2012b) Some of these factors are well recognized ... second half, but the decline has stopped, and Class track mileage increased slightly between 2000 and 2002 Many major rail lines and terminals are now being upgraded to accommodate more rail traffic ... travel as they earn more and become parents, they are unlikely to drive as much as the Baby Boom generation Similar trends are occurring in other developed countries (Le Vine and Jones 2012) Car...
- 42
- 474
- 0
Báo cáo y học: "The V1-V3 region of a brain-derived HIV-1 envelope glycoprotein determines macrophage tropism, low CD4 dependence, increased fusogenicity and altered sensitivity to entry inhibitors" ppsx
... 70 macrophage tropism and is associated with brain infection and dementia Proc Natl Acad Sci USA 2006, 103:15160-15165 Martín-Garc a J, Cao W, Varela-Rohena A, Plassmeyer ML, GonzálezScarano ... viruses to test for the ability of various Env to mediate infection, Env-mediated cell -to- cell fusion assays are also commonly used to evaluate their ability to interact with receptors and mediate ... hours at 37°C At 2–3 days post-infection, the cells were washed with PBS and lysed, and the amount of entry mediated by each Env was measured by detecting luciferase activity (Luciferase Assay System,...
- 22
- 273
- 0
Báo cáo y học: "Vascular injuries after minor blunt upper extremity trauma: pitfalls in the recognition and diagnosis of potential "near miss" injuries" ppsx
... concern of a potential pectoralis muscle rupture Upon the repeat evaluation by the orthopedic team, an expanding hematoma was appreciated in the axilla and anterolateral chest wall Additionally, ... complained of left arm pain Her past medical history was relevant for chronic alcohol abuse On first evaluation, the left arm appeared cooler than the right arm, and there was a gross deformity and ... revealed an intact 5/5 motor function of the left hand and intact sensation to light touch and 2point discrimination The radial pulse was symmetrically palpable (2+) The patient was radiographically...
- 6
- 248
- 0
Báo cáo y học: "The integrins are a superfamily of cell adhesion receptors that bind to extracellular matrix ligands, cell-surface ligands, and soluble ligands. They are transmembrane α" ppsx
... example, the focal adhesion kinase/cSrc, and the small GTPases Ras and Rho) and adaptors (for example, Cas/Crk and paxillin) that assemble within dynamic adhesion structures, including focal adhesions ... head region to the integrin β cytoplasmic tail causes dissociation of the α and β tails and induces a conformational change in the extracellular region that increases its affinity for its ligand ... Integrins can be activated intracellularly by signals from G-protein-coupled receptors that lead to phosphorylation of the cytoplasmic domain of the β subunit The association of the α and β cytoplasmic...
- 9
- 356
- 0
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis
... decreases With the increase in salinity, the evaporation of water decreases due to increase in ion activity and the reduction of thermodynamically spontaneous change of a liquid phase into a vapour ... collectors is taken as outlet temperature of the parallel combination Each flat plate collector has an area of 1.35m2 inclined at an angle equal to latitude of Chennai (13o) facing towards due ... condensation The outlet temperature from the flat plate collectors, latent heat and refined latent heat of vaporization of water from each stage and specific heat capacity of water from each stage are averaged...
- 26
- 568
- 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc
... neutral and alkaline pH; PhyH-DII was less stable under the same conditions (Fig 2D) PhyH was basically stable at 35 °C, and retained 60% of the initial activity at 45 °C for 90 when assayed at ... sum of PhyH-DI and PhyH-DII and two times greater than that of PhyHDII This large variance cannot be ascribed to the function of PhyH-DI alone The dual-domain phytase was shown to be a dimer according ... fused to another single-domain phytase may improve the catalytic efficiency of the latter Materials and methods Strains, plasmids and chemicals E coli Trans1-T1 (TransGen, Beijing, China) and pGEM-T...
- 9
- 801
- 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt
... used as template for quantitative RT-PCR analysis The M sexta ribosomal protein S3 (rpS3) mRNA was used as an internal standard to normalize the amount of RNA template The primer pairs used are ... representing the proHP8Xa zymogen, a truncated form of proHP8Xa and the catalytic domain of active HP8 are marked with arrowheads The size and position of molecular weight standards are indicated on the ... ¨ 3¢-RACE and 5¢-RACE to obtain the missing ends of the cDNA, and then used primers encompassing the start and stop codons, with larval fat body cDNA as template, to obtain eight individual clones...
- 15
- 540
- 0
Báo cáo khoa học: Investigation of the substrate specificity of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics analysis pdf
... sequence was 5¢-GGAGTCTAATGGACAACTTTNNNTGGATGGA GGGTTATATTGAGCG-3¢, with GAC, CAA and TCA as mutated codons for E451D, E451Q and E451S, respectively DNA sequencing was used to confirm the incorporation ... ÔeÕ stands for an equatorial hydroxyl and a for an axial one Therefore, the interaction between any residue at position 39 and an equatorial 4-OH was called /4e, and between any residue at position ... interact with E451, whereas the E39 side-chain (Oe atom) may form the /3 interaction E39 Oe and Q39 Oe atoms may form similar /3 interactions, as glutamate Oe and glutamine Oe atoms have similar...
- 9
- 371
- 0
Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf
... AAACATATGCTATATTACAATAAAA GG; 2.2up, AAACATATGTTATCTATCGTTGTAAAGC; 2.3up, AAACATATGCTTGTTCCTCAAAAACTTCC; 3.3rv, AAACTCGAGGACCTTAGCCGTAGTCTTCAC; 3.2rv, AAACTCGAGTTTTCCATTCAAAACCGTG Construction of ... Functional and structural characterization of the catalytic domain of the starch synthase III from Arabidopsis thaliana Proteins 70, 31–40 Senoura T, Asao A, Takashima Y, Isono N, Hamada S, Ito H ... Construction of the pNAL1 vector for the expression of CD of SSIII from A thaliana and truncated proteins The plasmid named pVAL3 containing the catalytic C-terminal domain of SSIII (1374 bp) was used as...
- 13
- 457
- 0
Báo cáo Y học: Synthesis, conformational analysis and biological activity of cyclic analogs of the octadecaneuropeptide ODN Design of a potent endozepine antagonist pot
... modification, and only a slight change of the rmsd values was observed for the backbone atoms Calculations and statistics Data are expressed as mean ^ SEM Student’s t-test was used to determine statistical ... support and the headto-tail cyclization was achieved using orthogonal allyl protection for the a- carboxylic function of aspartic acid (Fig 1) After the last coupling cycle and removal of the allyl ... procedure, aspartic acid was attached to the solid support via the b-carboxyl group whereas the a- carboxylic group was protected as allyl ester Monitoring of peptide deprotection and lactamization...
- 13
- 632
- 0
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc
... and intrarenal vascular tissue decreasing glomerular filtration rates [29], stimulation of apoptosis of immature thymocytes [30] TXA2 has been implicated as a mediator of a number of vascular disorders ... Subsequently 100 lL of the Stop/ Glo Reagent TM was added and luminescence due to renilla luciferase was measured Relative firefly to renilla luciferase activities were calculated as a ratio and were expressed ... Statistical analysis The organization and the exon-intron boundaries of the human thromboxane (TX) A2 receptor (TP) gene and the theoretical range of putative TP mRNA transcripts are 4062 A T...
- 16
- 321
- 0
the broadband problem anatomy of a market failure and a policy dilemma
... broadband services Furthermore, for technical reasons, because they use far more data and rely heavily on images and sound as opposed to text, broadband services are far more difficult to monitor ... flexibility, and income required to purchase and use personal computers and to obtain access to the Internet and to the data and services available on it Contrary to popular belief, however, the primary ... decree, and as a result of the settlement the 1984 breakup of AT&T (Interestingly the AT&T case, arguably the most important and aggressive antitrust action in many decades, was both filed and settled...
- 253
- 405
- 0
Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx
... equation J Inequal Appl 2011 (2011) Article ID 194394 13 Kenary, HA: On the Hyers-Ulam-Rassias stability of a functional equation in non-Archimedean and random normed spaces Acta Universitatis Apulensis ... Del Circolo Math Di Palermo (to appear) Kenary, HA, Shafaat, Kh, Shafei, M, Takbiri, G: Hyers-Ulam-Rassias stability of the Appollonius quadratic mapping in RNspaces J Nonlinear Sci Appl 4, 110–119 ... Hyers-Ulam-Rassias stability of approximately additive mappings J Math Anal Appl 184, 431–436 (1994) doi:10.1006/jmaa.1994.1211 Skof, F: Local properties and approximation of operators Rend Sem Mat...
- 14
- 479
- 0
Báo cáo khoa học: "Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine" pdf
... plasmids were used as controls 2.4 Gel retardation analysis A DNA fragment used for gel retardation analysis containing a sequence from the 5’-untranslated region of GS 1a was obtained by cleavage with ... in all compared organisms We have also analyzed the presence of putative elements in the 5’ region of the gene There is a canonical TATA box at –35 bp from the transcription start site and a putative ... facilities of the Molecular Biology Laboratory, Research Services, Universidad de Málaga The nucleotide sequence data reported are available in the EMBL, GenBank and DDBJ Nucleotide Sequence Database...
- 6
- 327
- 0
Báo cáo khoa học: "Extra-gastrointestinal stromal tumor of the greater omentum: report of a case and review of the literature" potx
... related to localization and size of the EGIST and to evaluate the impact of the molecular characterization as an outcome parameter related to the molecular targeted therapy In absence of these ... report of a case Surg Today 2006, 36:994-996 Todoroki T, Sano T, Sakurai S, Segawa A, Saitoh T, Fujikawa K, Yamada S, Hirahara N, Tsushima Y, Motojima R, Motojima T: Primary omental gastrointestinal ... abdominal wall and one located between liver and stomach) By means of a critical revaluation of the surgical reports and clinical histories and a careful search for residual muscular tissue from the...
- 5
- 365
- 0
Báo cáo khoa học: "Intensity-Modulated Radiotherapy for Squamous Cell Carcinoma of the Anal Canal: Efficacy of a Low Daily Dose to Clinically Negative Regions" ppsx
... superior to radiotherapy alone in the treatment of locally advanced anal cancer: results of a phase III randomized trial of the European Organization for Research and Treatment of Cancer Radiotherapy ... SIB to treat the elective areas and gross disease in the same number of fractions IMRT was able to significantly reduce the grade 2+ dermatologic and grade 3+ gastrointestinal/genitourinary events ... performed if physical examination findings were favorable Statistical Analysis The Kaplan-Meier method was used to calculate and estimate rates of overall survival and freedom from any disease...
- 19
- 374
- 0
báo cáo khoa học: "Endemic microorganisms of a Drosophila simulans strain and their relationships with the non-mendelian transmission of a character" ppt
... and methods Drosophila strains The strain in which the S character appeared was denominated SimES ; it was already described (C 1980 a and b) A second D simulans , OMENDADOR strain (Madagascar) ... shown to have properties : (i) it was more viable than the original strain and (ii) it retained the S character This last fact allows us to reject the hypothesis of a fundamental role of these pathogenic ... examples of maternal transmission of characters are known for the genus Drosophila In cases the causal factor appeared to be a microorganism : CO RUN sensitivity is due to the Rhabdovirus sigma (B...
- 13
- 218
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose