the proverbial monkey wrench results in a dominant trait
Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt
Ngày tải lên :
16/03/2014, 14:20
... These included the insects D melanogaster (AAB60217), A gambiae (EAA06264), A aegypti (AAK15810), S invicta (AAP92450) and P americana (BAC02725), and the vertebrates Anguila japonica (BAB64337), ... ootheca transport Ovarian BgVgR mRNA levels appeared high at the beginning of the last nymphal instar, steadily declining along the instar, and reaching the lowest values of the instar before the ... BgVgR localization in ovaries was examined by immunofluorescence in last instar nymphs, as well as in the adults In the first days of last instar nymphs, BgVgR protein was detected as a very faint fluorescence,...
- 11
- 414
- 0
báo cáo sinh học:" Using nurses to identify HAART eligible patients in the Republic of Mozambique: results of a time series analysis" potx
Ngày tải lên :
18/06/2014, 17:20
... responsible for the initial conception and design of the data, participated in the data analysis and drafted the original text MAM participated in the data analysis and made significant comments ... of the population Study data were derived from existing databases that are maintained at each clinic site and include data routinely collected as part of patient care These data include basic ... compare the hazard rates at which these patients started HAART before and after the intervention, using the date of the initial CD4 blood draw as the starting point for follow-up and following patients...
- 9
- 492
- 0
báo cáo hóa học:" Assessing the construct validity of the Italian version of the EQ-5D: preliminary results from a cross-sectional study in North Italy" docx
Ngày tải lên :
20/06/2014, 15:20
... Dallolio coordinated data entry and data analysis, Dr Savoia provided assistance with data analysis and the narrative of the manuscript All authors revised the text and provided information and ... mobility impairment Angina, asthma and COPD mainly affected the usual activities domain Angina was associated with the anxiety and depression domain with 210% increased odds of reporting impairment ... domain, and a 370% increased odds in the usual activities domain (OR = 4.7, 95% C.I 3.3–6.7) Having a headache at least once a week affected mainly the pain and discomfort domain with a 300% increased...
- 9
- 421
- 0
Báo cáo y học: " Variability in a dominant block to SIV early reverse transcription in rhesus monkey cells predicts in vivo viral replication and time to death" pot
Ngày tải lên :
12/08/2014, 04:20
... participated in all assays SL participated in B-LCL phenotyping and staging assay TS participated in B-LCL phenotyping, staging, and fusion assay TC participated in staging and fusion assay AH participated ... forward, 5'-AAGCAAGTGTGTGTTCCCATCT-3'; late RT reverse, 5'-CACTTACCTGCAACCGGAGG-3'; integrated forward, 5'-GCTGCCGATTGGGATTTACAAC3'; integrated reverse, 5'-AATGTCTGATCCTCTTGGCTCTC-3' Quantification ... findings underscore that an innate antiviral response, which is capable of inhibiting early RT, can impact the in vivo clinical outcome of the animals infected with SIV A complete understanding...
- 11
- 340
- 0
Báo cáo y học: "Mutagenesis of tyrosine and di-leucine motifs in the HIV-1 envelope cytoplasmic domain results in a loss of Env-mediated fusion and infectivi" pps
Ngày tải lên :
13/08/2014, 01:20
... 5’CCTGACTCCAAGACTGTTGGTGATTCCACCAAGATTTGAGGGCTTCC3’, LL814AAFP - 5’GC TGTTAACGCGGCCAATGCCAATGCCACAGC3’, LL814AARP - 5’GGCATTGGCCGCGT TAACAGCACTATTC3’, LL855AAFP - 5’GGGCTTGGAAAGGATTGCGGCATAAGATGGG3’, ... perhaps because in the absence of Y712 necessary adaptin interactions are impaired Despite an increase in surface expression in the Y712C-containing mutants, there was a progressive decrease in ... membrane occurred in the absence of all of the conserved Y and LL motifs in the CD, arguing against a critical role for them in outward transport of the protein Plasma membrane location alone was...
- 17
- 362
- 0
A CFD analysis on the effect of ambient conditions on the hygro-thermal stresses distribution in a planar ambient airbreathing PEM fuel cell
Ngày tải lên :
05/09/2013, 14:58
... potentially causing localized increases in the stress magnitudes, and this leads to mechanical damage, which can appear as through -the- thickness flaws or pinholes in the membrane, or delaminating ... near the cathode side area The maximum stress appears in the cathode side surface of the membrane, implying that major heat generation takes place near this region It can be seen also that the ... differential between the fuel cell stack and the operating environment make thermal management a challenging problem in PEM fuel cells As the ambient temperature increases, the air-breathing fuel...
- 16
- 727
- 0
Tài liệu Báo cáo khoa học: Yeast glycogenin (Glg2p) produced in Escherichia coli is simultaneously glucosylated at two vicinal tyrosine residues but results in a reduced bacterial glycogen accumulation docx
Ngày tải lên :
19/02/2014, 16:20
... to the mass of the amino acid residue at that position in the sequence An additional relative molecular mass increment of 162 Da reveals that a hexose is attached to the corresponding amino acid ... with incubation time suggesting a progressive glucosylation of the recombinant glycogenin (Fig 1) For a more detailed analysis, the dominant protein band from the patterns obtained at the beginning ... a complex pathway that includes the action of amylomaltase (malQ), maltodextrin phosphorylase (malP) and maltodextrin glucosidase (malZ) [33] It is not inconceivable that a similar oligoglucan...
- 12
- 513
- 0
Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt
Ngày tải lên :
21/02/2014, 20:20
... expands, the correct denotational relationship is maintained by expanding the image in the table using the ~-expression, and then finding the corresponding element in the model If the element in the ... that was the denotation of the h-expression was not expanded in the same way as the image in this table, a new element corresponding to the expanded image is added to the model This table allows ... equivalent to (2) above) * Meaningful names are also useful for other purposes, such as generating sentences from the information in the model and for providing procedural rather than declarative...
- 3
- 394
- 0
Tài liệu Analysing different technology pathways for the pulp and paper industry in a European energy systems perspective doc
Ngày tải lên :
22/02/2014, 09:20
... Increased thermal efficiency in Scandinavian integrated TMP and paper mills Analysing the potential for steam savings using the Heat Load Model for Pulp and Paper Chemical Engineering Transactions ... products, as generated by the ENPAC tool, used as part of the input data in Papers I-III, V, VII and IX, are presented along with other input data in Chapter Another option for evaluating the future ... kraft pulp mill based on data from a model mill depicting a typical Scandinavian pulp mill As an addition, Papers IV, VI and VIII are based on data from existing European pulp and paper mills and...
- 124
- 648
- 0
THE CONSTITUTION OF LAW Legality in a Time of Emergency potx
Ngày tải lên :
07/03/2014, 02:20
... legislating how they are to balance liberty against security and amending the Human Rights Act 1998 In contrast, the Spanish government elected in the immediate aftermath of the attacks on Madrid ... that Smuts was a racist, whose own policies in South Africa laid the basis for apartheid: after all, in holding racist views, he was in the mainstream of politics Rather, he strongly favoured a ... Reconciliation and the Apartheid Legal Order (Oxford: Hart Publishing, 1999) A S Mathews and R C Albino, The Permanence of the Temporary: An Examination of the 90- and 180-Day Detention Laws’ (1966)...
- 268
- 661
- 0
THE CONSTITUTION OF LAW Legality in a Time of Emergency docx
Ngày tải lên :
07/03/2014, 02:20
... legislating how they are to balance liberty against security and amending the Human Rights Act 1998 In contrast, the Spanish government elected in the immediate aftermath of the attacks on Madrid ... that Smuts was a racist, whose own policies in South Africa laid the basis for apartheid: after all, in holding racist views, he was in the mainstream of politics Rather, he strongly favoured a ... Reconciliation and the Apartheid Legal Order (Oxford: Hart Publishing, 1999) A S Mathews and R C Albino, The Permanence of the Temporary: An Examination of the 90- and 180-Day Detention Laws’ (1966)...
- 268
- 1.1K
- 0
Expect the Unexpected: Building business value in a changing world pptx
Ngày tải lên :
15/03/2014, 21:20
... are interconnected They interact Intergovernmental treaties are yet to solve the issues and, at a national level, the transition to sustainable growth remains a goal rather than an achievement The ... geographically and in terms of type of usage: municipal and domestic, agricultural or industrial Agriculture in India, sub-Saharan Africa, and Asia (excluding China) is forecast to create the ... felt The financial crisis accelerated the shift of economic, financial and political power toward the developing world, in particular to dynamic emerging market nations such as China, India and...
- 180
- 413
- 0
Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot
Ngày tải lên :
23/03/2014, 17:21
... 5¢-AAATGCTTCAATGATAT CGAAAAAGGAAG-3¢, converted a unique SspI site on the vector to an EcoRV site The mutagenesis oligonucleotides were 5¢-GTAACTGTAAGAGAACTGGTCAC-3¢ (Lys70 to Arg), 5¢-GTAACTGTAGCAGAACTGGTCA ... hydrazine caused the Soret absorbance peak to initially shift to 438 nm and increase in intensity then greatly diminish over several minutes, while absorbance at 500 nm decreased and absorbance at ... was obtained from N europaea by D M Arciero as described earlier [22] for use as an electron acceptor in assays of hydroxylamine and hydrazine oxidation by cytochrome P460 In these assays, the...
- 7
- 384
- 1
Báo cáo khoa học: Fission yeast decaprenyl diphosphate synthase consists of Dps1 and the newly characterized Dlp1 protein in a novel heterotetrameric structure doc
Ngày tải lên :
23/03/2014, 21:20
... T., Tanaka, K., Nakagawa, T., Matsuda, H & Kawamukai, M (1998) Molecular cloning and mutational analysis of the ddsA gene encoding decaprenyl diphosphate synthase from Gluconobacter suboxydans ... diphosphate transferase (ppt1) as follows The mitochondrial transit sequences were amplified by PCR using the oligonucleotides 5¢-AGGTCGACAGA TTAGCATGTAAATAG-3¢ (creates a SalI site) and 5¢-CGAAGCTTGGGGGTTACAGAGTTTGA-3¢ ... Biophys Acta 1302, 217–223 16 Okada, K., Kamiya, Y., Zhu, X., Suzuki, K., Tanaka, K., Nakagawa, T., Matsuda, H & Kawamukai, M (1997) Cloning of the sdsA gene encoding solanesyl diphosphate synthase...
- 9
- 337
- 0
The Art of Grief The Use of Expressive Arts in a Grief Support Group pptx
Ngày tải lên :
29/03/2014, 04:20
... Koff-Chapin Center for Touch Drawing Langley, Washington Carol McIntyre, MA The Painting Place Santa Rosa, California Carol M McNamee, PhD Director, The Arts in Healthcare Project The Family Therapy ... Alternative Art Forms, Programs, and Stories of Art and Healing Chapter 14 The Painters Deborah Koff-Chapin, Carol McIntyre, and Judith Koeleman 153 Chapter 15 The Writers Sara Baker and Sara ... creative spirit: Deborah Koff-Chapin, Carol McIntyre, Judith Koeleman, Sara Baker, Sara Spaulding-Phillips, Debra Mier, Laura Thomae, Carol McNamee, Sandra Baughman, Laura Kiser, Janet Feldman,...
- 324
- 639
- 0
the mit press the really hard problem meaning in a material world nov 2007
Ngày tải lên :
11/06/2014, 12:59
... hip-hop and West Indian reggae, sculpts Maasai folk images in teak, has deep knowledge of the flora and fauna of Tanzania and Kenya, and works at a distance against the genocide in Sudan can also ... spirituality in many meetings in India and America over the last decade I am grateful to them all Alan Wallace and Rob Hogendoorn stand out as especially helpful critics Finally, as always, there are public ... bound in the United States of America Library of Congress Cataloging -in- Publication Data Flanagan, Owen J The really hard problem : meaning in a material world / Owen Flanagan p cm ‘ A Bradford...
- 305
- 334
- 0
báo cáo sinh học:" Human resource leadership: the key to improved results in health" pptx
Ngày tải lên :
18/06/2014, 17:20
... of thinking about leading and managing to sustain these positive results and scale them up Health managers at a recent HR leadership meeting in Southern Africa described their problems as follows: ... participants often replicate the principles in many areas of their work and teach them to others The LDP makes a profound difference in health managers' attitudes toward their work Rather than feeling ... of the LDP has been adapted, for example, to accommodate people from rural areas The program has been translated into French, Spanish, Portuguese, and Arabic One important finding is that participants...
- 4
- 437
- 0
variation of the germinable soil seed banks in a pasture infested by parthenium hysterophorus l.at kilcoy, south-eastern queensland
Ngày tải lên :
19/06/2014, 11:35
... and other waste lands (Mahadevappa 1999) Parthenium weed has also spread into Trinidad, Guyana, Jamaica, Nepal, Israel, South Korea, Taiwan, North Vietnam, Bangladesh, Sri Lanka, southern China, ... that the major parthenium weed infestation areas in Australia are in the sub-coastal regions of central Queensland, where annual rainfall ranges between 500 and 700 mm with a dominant summer incidence ... to replace the dominant flora in a wide range of habitats including native grasslands, open woodlands, river banks, floodplains, national wildlife parks and wastelands (Asad & Rukhsana 2006;...
- 100
- 313
- 0
Báo cáo hóa học: " Evidence that the Nijmegen breakage syndrome protein, an early sensor of double-strand DNA breaks (DSB), is involved in HIV-1 post-integration repair by recruiting the ataxia telangiectasia-mutated kinase in a " pptx
Ngày tải lên :
20/06/2014, 01:20
... joining (NHEJ) DNA repair pathway and these data thus provide a link between the ATM kinase and NHEJ pathway We and others have presented extensive evidence indicating that NHEJ is involved in ... issue in understanding retroviral PIR concerns conflicting data in the literature about the roles of the ATM and ATR kinases Although many publications demonstrated the participation of other ... trimming the 2-bp flaps from the 5'-ends of the proviral DNA, filling in the single-stranded gaps that arose from the original staggered cleavage of host DNA, ligation of the trimmed 5' viral DNA...
- 12
- 398
- 0