... Australian intelligence community ANAO Australian National Audit Office AQMI Al-Qaida pour le Maghreb Islamique [al Qaeda for the Islamic Maghreb] ASALA Armenian Secret Army for the Liberation of Armenia ... edit ofthe document greatly improved the final product Abbreviations AAT Administrative Appeals Tribunal AD Action Directe [Direct Action] AFP Australian Federal Police AG Attorney-General AIC Australian ... sufficient adaptability to respond to dynamic threats Many terrorist organizations have demonstrated that they can rapidly alter their behavior and adapt their tactics in the face of CT pressure To keep...
... variation in the phenomenon To conduct an empirical examination of mentioned language and to study the feasibility of automatic identification, it was necessary to gather a large, diverse set of samples ... informatively and they generally assume the reader is unfamiliar with their topics, leadingto frequent instances of mentioned language 4) Wikipedia is freely available Various language learning materials ... Frequencies of each category in the subset labeled by additional annotators and the values ofthe Kappa statistic for binary relabelings The low value for remapped OM was expected, since the category was...
... work tothe Organization of American Historians, the American Historical Association, the American Studies Association, the Society for Historians ofthe Early American Republic, the History of Acknowledgments ... Pennsylvania, the American Antiquarian Society, the Baker Library ofthe Harvard Business School, the Boston Public Library, the Massachusetts Historical Society, and the Boston Athenaeum Some ofthe ... owe a heartfelt thanks tothe staff at the Rothschild Archive, the Bank of England Archive, the Baring Archive, the British Library Newspaper Reading Room, the National Archives at Kew, the Manuscript...
... supervise the banking activities of national banks It clarifies that state officials not have any authority to examine or regulate national banks except when another federal law has authorized them to ... business.2 To charter and supervise the national banks, the act created the Office ofthe Comptroller ofthe Currency (OCC) The act was refined in 1864 with passage ofthe National Bank Act Once the ... (according tothe FDIC Call Reports) were JPMorgan Chase Bank, NA; Bank of America, NA; Citibank, NA; Wachovia Bank, NA; Wells Fargo Bank, NA; Fleet National Bank; U.S Bank, NA; HSBC USA, NA; SunTrust...
... Economic and Financial Affairs of November 2011, some Member States declared that they were against any common systemoffinancial transaction tax at the level oftheEuropean Union unless an FTT of ... Commission took note ofa debate on-going at all levels on additional taxation ofthefinancial sector This debate originates from the desire to ensure that thefinancial sector fairly and substantially ... financial transaction tax THE COUNCIL OFTHEEUROPEAN UNION, Having regard tothe Treaty on the Functioning oftheEuropean Union, and in particular Article 329(1) thereof, Having regard tothe requests...
... countries as the navigators and learn the lessons from the ASEAN-5 The paper also explores that on the way to integrate the domestic financial market into the international one, Vietnam can evaluate ... theprocessof reforming thefinancialsystemof ASEAN-5 and Vietnam, thereby makes some evaluation on the stage offinancial development of Vietnam in comparison to those of ASEAN-5 61 and draws ... concerned, the ASEAN-5 financial systems were about ten times as large, with the total financial assets of 80% of GDP on average In Vietnam, financial depth has been a rather shallow with the underdeveloped...
... random choice of initial strategies, any bias towards a particular outcome in the active strategy set will propagate itself as a bias in the value of N0−1 away from zero Thus N0−1 should be approximately ... of strategies in play is comparable tothe total number available, and where r ∼ 0.5 In addition to producing realistic dynamical features such as in Fig 1, this regime yields many ofthe statistical ... simulations We then identify a third-party game that achieves the maximum correlation between the price-change ∆P (t) and our explanatory variable S0−1, with the unexplained variance being characterized...
... - FASAC American Accounting Association- AAA Financial Accounting Foundation -FAF Is this issue a candidate for the agenda? Yes Agenda Decision DECISION PACKAGE: FASB Staffers prepared Agenda ... tothe FASB agenda According to Reither (1997), the factors that the FASB uses to evaluate adding a project tothe agenda are as follows: Pervasiveness ofthe problem: the extent to which an ... influenced the final published financial accounting 32 standard By applying the cross-case analysis design on two random and separate financial accounting standards (secondary archival data), analytic...
... areas, the multiple-access channel data rates and the hub sector capacities to meet the projected traffic load is also discussed The use of Monte Carlo simulations to evaluate the quality ofa ... propagation and channel models As discussed ORGANIZATION OF THIS BOOK 21 in this chapter, the accuracy ofthe propagation model is often limited by the accuracy ofthe physical databases rather ... in a straight line along the z-axis The planes perpendicular tothe z-axis are known as the wave fronts If the wave is moving in a straight line and all the wave fronts are parallel, the wave...
... lead to automatic recognition ofthe diploma; and (b) the “general system , which may require a case-by-case evaluation ofthe diploma by national authorities with the option to impose compensation ... towards rehabilitative and alternative treatments and tourist interest in India In general, the UK was seen as the main market for language and culture-dependent areas and emerged as the main market ... medical value travel • Partnerships and affiliations among labs and research centres to facilitate work in the area of clinical trials, and global recognition and certification of Indian labs...
... The Act allowed pharmaceutical companies to pay fees to speed the approval process and the FDA the ability to use these fees to finance the specific areas After the Act was launched, new approvals ... the public health systemto financially cover new treatments are part ofthe strategies ofthe pharmaceutical industry to create the health consumer and the impact that the mandates have on the ... health is a right that the state must guarantee and that each Brazilian has the right to universal and integral access to health care The constitutional nature ofthe right to health opens the...
... successes (the Apple II and the Macintosh), the mission seemed plausible With the hype and buzz that has become a hallmark of an Apple product launch, early Newton advertising proclaimed: The astonishing ... guessing!” Pat Sullivan, Creator of ACT! and SalesLogix The way today’s leaders create a sustainable, growing, and successful company is to instill a company culture of working as trusted advisors to ... from the marketplace At some of these industry laggards, a finance-driven approach is used where a slew of MBA-types crunch numbers all day and dictate what happens at the strategic level of the...
... TACCCTCCTTGCGCTCAATC GCGATTCCTTTTGGAGAAGAC TCGATATCCACATCGTCAGC CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix ... decreased as they adapted to darkness The habituation effect can also be seen as the decrease of active time toward the end ofthe dark phases, though the point of reaching maximal activity varied ... contributed tothe dramatic boost in the distance that larvae moved in the dark Larvae responded tothe onset of darkness with a strong startle, causing a maximal peak on the speed actogram, then their...
... Agenda Would the amended theory offinancial intermediation lead toa new research agenda? Partly Battacharya and Thakor have listed what they regard as the key questions and puzzles for financial ... ofthe firm evolved under the paradigm ofthe agency theory and the transaction costs theory as a theory of economic organization rather than as a theory of entrepreneurship A separate line of ... items, rather than their very limited own funds, to act as such counterparts An Alternative Approach ofFinancial Intermediation 35 The mainstream offinancial innovations in the past decades was...
... Liquidity Management: Bank of Canada Advances Borrow $9 million from the Bank of Canada Assets Reserves Liabilities $9M Deposits Loans $90M Advance Bank of Canada Securities $10M Bank Capital • Borrowing ... Dura – (L /A x DURL) Where: Dura = average duration of assets L = market value of liabilities A = market value of assets Durl = average duration of liabilities Duration Analysis IV The impact of ... Capital Adequacy Management • Bank capital helps prevent bank failure • The amount of capital affects return for the owners (equity holders) ofthe bank • Regulatory requirement Capital Adequacy...
... three banks having about a 3/4 share ofthe total loan market In Hong Kong, Malaysia, and Thailand, the top three banks have about half ofthe loan market, while in the other markets the top three ... certain regulatory and tax advantages, which already suggests a desire to allow more internationalization Several Asian countries have also stated their aim to make their country a regional financial ... countries, and the heavy role ofthe government in thefinancial sector To date, for example, almost always bank depositors, and often bank owners and managers as well, have not been asked to bear the...
... training, the number of years that the money manager has lived in the village, the age ofthe money manager, the log ofthe years that the village bank has been in operation, a variable that ... the estimates include a variable that is equal to one if the village bank makes loans in the case of estimates of participation in savings banks and an analogous variable for saving in the case ... received any accounting training and the interaction of village and money manager education are insignificant in all ofthe specifications The age ofthe money manager and the number of years that the...
... Historically, advances in communications arose out ofthecreationof highways for stagecoaches, the building of railroads, the advent ofthe airplane In each instance, the post was able to rapidly ... organization, as in Bangladesh and India; 2) the postal savings bureau, as in China, Japan and the Republic of Korea; 3) the linkage of savings toa postal payments system, as proposed in Kazakhstan ... for the next 30 years (until the advent ofthe Russo-Japanese War) The Japanese model has also had an impact on the Republic of Korea, Taiwan Province of China and many other ar- 19 Postal Savings...