the paper contains a major debunking of previously held ideas
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc
... activity, in the absence of inactiva- tion of phosphorylase, causes a large activation of glycogen synthase but a small stimulation of glycogen synthesis; (c) that the stimulation of glycogen synthesis ... by inactivation of phosphorylase is associated with both activation and translocation of glycogen synthase, and that the former mechanism alone cannot explain the stimulation of glycogen synthesis ... of the phosphorylase inactivator, we suggest that additional factors may be involved in translocation of glycogen synthase and that phosphorylase a itself may be an important determinant of the...
- 9
- 381
- 0
Báo cáo y học: "Small variable segments constitute a major type of diversity of bacterial genomes at the species level" pptx
... Kurokawa K, Ishii K, Yokoyama K, Han CG, Ohtsubo E, Nakayama K, Murata T, Tanaka M, Tobe T, Iida T, Takami H, Honda T, Sasakawa C, Ogasawara N, Yasunaga T, Kuhara S, Shiba T, Hattori M, Shinagawa ... post-treatment step as described above was then applied [5] Compared to MGA, the MAUVE software offers the advantages of dealing with large rearrangements, and the possibility to treat high numbers of ... number of genomes included in the alignment Given the abundance of annotated data available for E coli in databases, we selected this species to perform a mapping of the VSs to available annotations...
- 15
- 424
- 0
Báo cáo y học: "The website contains a wealth of information regarding the management of trauma victims, as well as news about upcoming conferences and event" potx
... This website contains two interactive scenarios for each of the topic areas of advanced cardiac life support, of acute leg swelling and of acute coronary syndrome The cases are detailed and well ... feature Several of the vignettes contain unnecessary text that becomes a nuisance to skim through Wish list More scenarios in the format of the ‘trauma team leader decision scenarios’ Other links ... Critical Care April 2003 Vol No Scales Overall, I found the trauma scenarios to be well presented and educational More importantly, they were actually fun to work through, and seemed to be appreciated...
- 2
- 248
- 0
Báo cáo y học: "Background: Mood disorders including depression and bipolar disorders are a major cause of morbidity in childhood and adolescence, and hospitalizations for mood disorders are the leading diagnosis for all hospitalizations in general hospit
... Page of Methods The Kids’ Inpatient Database (KID) is one in a family of databases and software tools developed as part of the Healthcare Cost and Utilization Project (HCUP), a Federal-State-Industry ... recently available at the time [14] The unit of analysis is a hospitalization, and it is possible that an individual patient contributes more than one hospitalization to the database in any given year ... in the West [11] Our data go beyond the earlier analysis by using the hospitalization data to calculate population based rates Other aspects of mental health care utilization have been examined...
- 9
- 449
- 0
Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh
... canal and ponds It was partly because the people had considered the biogas plant as maintenance free and they did not any maintenance at all with lack of the appropriate technical knowledge Also, ... populated countries of the world, with a population of about 129 million in 2001(Bangladesh Bureau of Statistics, 2002) Dhaka is the capital city of Bangladesh, and Bauniabad is one of the urban ... and water quality analysis of the biogas plants were conducted BACKGROUND Study area Bangladesh lies in the northeastern part of South Asia, and has an area of 147,570 km2 It is one of the most...
- 9
- 971
- 0
Tài liệu Báo cáo khoa học: ˚ The 1.8 A crystal structure of a proteinase K-like enzyme from a psychrotroph Serratia species docx
... The N-terminal pro domain is autocatalytically cleaved off when the enzyme has obtained its active conformation, and the two C-terminal domains are cleaved off by heat treatment at 50 °C An Ala-Pro-Thr ... SPRK also has an aspartic acid residue at position at 200, and with the same conformation as in the two other structures, but Asp200 forms a salt bridge to Lys253 (Ala253 and Asn250 in PRK and ... from a Serratia sp R Helland et al Structure in the binding region The electrostatic surface calculated by icm (Fig [28]) shows that the bacterial peptidases have a more anionic character than the...
- 11
- 551
- 0
Tài liệu Báo cáo khóa học: The PAS fold A redefinition of the PAS domain based upon structural prediction ppt
... alignment that all PAS-annotated A thaliana proteins also contain a PAC motif, and conversely that all PACannotated A thaliana proteins contain a PAS domain Therefore, in the case of A thaliana, ... 273–379 P39272 233–339 PFAM PAC NA NA NA NA NA NA NA NA NA NA PAC PAC PAC PACa PAC PAC PAC PAC PAC PAC PAC PAC PAC NA NA B_19516 PROSA z-score (best model) z-Score after Align-2D (best model) )6.04 ... 1205 Fig Alignment of all A thaliana sequences that are either annotated as a PFAM PAS domain or as a PFAM PAC motif Regions of sequences that have an amino acid sequence similarity > 35%, are depicted...
- 11
- 592
- 0
Tài liệu THE BUFFETT RULE: A BASIC PRINCIPLE OF TAX FAIRNESS docx
... of the Richest Americans Pay Extraordinarily Low Tax Rates The average tax rate masks the fact that some high-income Americans pay near their statutory tax rate, while others take advantage of ... low tax rates—as they hire lawyers and accountants to take particular advantage of loopholes and tax expenditures The average tax rate masks the fact that some high-income Americans pay near their ... wealthiest Americans can hire lawyers and accountants to take advantage of tax expenditures and loopholes that enable them to pay a lower share of their income in taxes than average Americans In particular:...
- 8
- 384
- 0
Research Program of the Partnership for a New Generation of Vehicles doc
... OFFUTT, Program Officer SUSANNA CLARENDON, Financial Associate PANOLA GOLSON, Project Assistant ANA-MARIA IGNAT, Project Assistant SHANNA LIBERMAN, Project Assistant NAE = National Academy of Engineering ... Laboratory, Lawrence Berkeley National Laboratory, Sandia National Laboratories, Los Alamos National Laboratory, National Renewable Energy Laboratory, Argonne National Laboratory, Oak Ridge National ... technical area is a major collaborative effort of the individual partners, the national laboratories, and a few universities The Pacific Northwest National Laboratory, Lawrence Livermore National Laboratory,...
- 134
- 466
- 0
Strengthening the Education Sector Response to School Health, Nutrition and HIV/AIDS in the Caribbean Region: A Rapid Survey of 13 Countries pdf
... buildings and facilities in all schools Anguilla Antigua The Bahamas Barbados Belize Dominica Grenada Guyana Jamaica St Kitts & Nevis St Lucia St Vincent & Grenadines Trinidad & Tobago Table Education ... society organizations and others In six countries, namely the Bahamas, Barbados, Grenada, Guyana, Jamaica and Trinidad and Tobago, support is given to a Sector Wide Approach (SWAP) in education with ... or a separate HIV unit within the MoE In the case of Belize, an HFLE unit in the MoE addresses SHN-and HIV-related activities Orphans and Vulnerable Children Anguilla Antigua The Bahamas Barbados...
- 40
- 450
- 0
Báo cáo khoa học: Arginine-induced conformational change in the c-ring ⁄a-subunit interface of ATP synthase ppt
... view of the surface of the c-ring of I tartaricus The atom boundaries are displayed as surfaces to visualize the cavity at the P-side of the ionbinding site The residues of the ion-binding site and ... responsible for the amount of ac cross-link formation, we took advantage of the fact that the protonation state of a histidine residue can be changed in the near-neutral range [pKa(His) = 6.0] The experiments ... below the figure are the average (mean) yields of ac cross-link formation (as a percentage of the total amount of a subunit) (B) Formation of ac cross-linking products between aN230C and mutants...
- 14
- 592
- 0
The Anime Machine: A Media Theory of Animation
... be as easily produced by sliding the drawing under the camera, rather than moving the camera Because of the relative immobility of the camera, the emphasis in animation often falls on drawing the ... between the apparatus (animation stand) and machine (multiplanar machine or animetic machine) Thus, while I will start with the animation stand as the apparatus of animation that to some extent accounts ... call “animetism.” Characteristic of animetism is the separation of the image into multiple planes The result is a multiplanar image Insofar as animetism arises in the same world as mobile apparatuses...
- 425
- 706
- 3
The raman effect a unified treatment of the theory of raman scattering by molecules derek a long
... A1 4.7.5 Isotropic averages and the rotational invariants G j , a, υ and for the cartesian basis A1 4.7.6 Isotropic averages and rotational invariants, G j , a, υ and for the spherical basis References ... rotational invariants G j in terms j of the ˛m A1 4.7.3 Isotropic averages and rotational invariants G j in terms of the ˛ A1 4.7.4 Isotropic averages and rotational invariants G j in terms of the ˛ A1 4.7.5 ... xvii A A15 The Optical Activity Tensors, G, G , A and A A15.1 Introduction A1 5.2 Isotropic Averages of the Type haG i A1 5.3 Isotropic Averages of the Type haAi A1 5.4 Other Tensor Invariants Reference...
- 611
- 443
- 0
Viral Spiral - How the Commoners Built a Digital Republic of Their Own potx
... proteins, and marine biology often cannot access databases containing vital research Or they cannot easily share physical samples of lab samples When the maker of Golden Rice, a vitamin-enhanced ... under way The volunteers include avant-garde artists in Croatia, free software programmers in the Netherlands, South Korean judges, Italian law professors, South African musicians, Malaysian citizenjournalists, ... demonstrate the feasibility of large-scale software collaboration and the deep well of innovative ideas that it could yield Emacs enabled programmers to add new features with great ease, and to constantly...
- 352
- 297
- 0
The German Implementing Act for the AIFM Directive: A Critical Survey of the Draft Bill ppt
... in Kazakhstan are provided by the Almaty branch of Dechert Kazakhstan Limited A list of the names of the directors of Dechert Kazakhstan Limited is available for inspection at its registered office: ... the meaning of the draft of the GIC In contrast, in the scope of application of the Regulation on European venture capital funds (still in the draft phase), what are known as ‘semiprofessional’ ... requirements already given in the InvA (e.g., verification of the legality of the AIF management company’s instructions) Impact on Taxation According to the reasoning of the draft of the GIC, the revision...
- 13
- 514
- 0
Báo cáo Y học: Structural study on lipid A and the O-specific polysaccharide of the lipopolysaccharide from a clinical isolate of Bacteroides vulgatus from a patient with Crohn’s disease ppt
... length of the fatty acid on the acyoxyacyl group to be mainly 15, confirming the result of the compositional analysis In the minor triacylated lipid A, the fragmentation patterns of the parent ion at ... phosphate The latter component may be a byproduct of the hydrolysis reaction or a natural contaminant These results indicate that the LPS from B vulgatus mainly contains lipid A carrying four fatty ... mass spectrum revealed the presence of a monophosphoryl lipid A (Fig 3A) The molecular mass heterogeneity can be explained by the degree of acylation and the chain length of the fatty acid The...
- 7
- 437
- 0
philosophy in the modern world a new history of western philosophy volume 4 jun 2007
... other children, but was educated at home by his demanding father He began to learn Greek at the age of three and by the age of twelve had read much of Plato in the original At that age he began ... Ireland, and published a pamphlet advocating a radical reform of the landholding system He advocated proportional representation in parliamentary elections, as a safeguard against the exercise of ... but Abraham breaks a moral law in obedience to an individual command of God This is what Kierkegaard calls the teleological suspension of the ethical’—Abraham’s act transgresses the ethical order...
- 364
- 422
- 0
báo cáo hóa học: " Type D personality in the general population: a systematic review of health status, mechanisms of disease, and work-related problems" docx
... [41] Finally, Type D was a strong predictor of adverse cardiac outcome after acute myocardial infarction, and the associated risk was similar to that of traditional cardiovascular risk factors ... from the general population The primary aim of the present study was to review all the available evidence concerning Type D personality in relation to mental and physical health status among apparently ... Six studies examined behavioral and biological mechanisms of disease as a function of Type D personality in apparently health individuals (Table - section a) Regarding behavioral mechanisms, two...
- 10
- 595
- 0
Báo cáo khoa học: "Serous adenocarcinoma of the fallopian tube, associated with verrocous carcinoma of the uterine cervix: a case report of synchronic rare gynecological tumors" pps
... probably the most important is the nature of the cervical neoplasm which was preinvasive carcinoma in Ayas' case while in ours was an invasive rare variant of squamous carcinoma, and the other ... induced anaplastic changes that lead to regional and distant metastases as a consequence [5,7,9] Recently there are some case reports of cervical and tubal carcinomas, one of them [14] was associated ... cervical carcinoma and IA G3 fallopian tube carcinoma according to FIGO staging system The patient declined any adjuvant treatments, either chemotherapy or radiotherapy or both The patient remained...
- 5
- 384
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25