... Timeline, and how to manipulate layers and frames You should also be familiar with importing and using bitmaps and sounds, and assigning basic actions to frames and buttons for navigation Review the ... Instances Target Paths Absolute and Relative Paths Using the with Action to Target Movie Clips Slash Notation and tellTarget Scope Movie Clips As Containers Managing Outside Communication Communicating ... keyframe (top), and delete the last keyframe (bottom) This technique makes the animation not have to play two identical frames (the first andthe last) and creates a smooth loop A motion path in a...
... downward trend in the personal saving rate clearly has failed to involve only the United States: Similar dynamics also characterize, for instance, Canada and Australia.24 In particular, the Australian ... 496 that the average tax rate and (realized and total) rates of return on assets are not too large, the NIPA personal saving rate is bound to systematically underestimate the true personal saving ... DECLINE REAL? MEASUREMENT ISSUES There are two basic sources of calculated values forthe personal saving rate: the NIPA estimates from the BEA andthe estimates of the changes in personal net wealth...
... (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig 1A) The ... whether there is an association between the NPPB gene and EH Acknowledgments We would like to thank Dr Y Watanabe and Dr Y Izumi for collecting the samples, and Ms H Tobe, M Nakamura, and K Sugama ... AAGGAGGCACTGGGAGAGGGGAAAT -3’ (bases -1323 to -1299 from the major transcriptional initiation site) and antisense, 5’-AATTAGCTGGGCATGGTGGCAGGCG-3’ (bases -1075 to -1051)) that recognize part of the...
... stack of nodes to be expanded, as well as a history, probability, and FOM The highest ranked analysis is popped from the pending heap, andthe category at the top of its stack is expanded A category ... in the training corpus was transformed before grammar induction, resulting in a transformed PCFG and lookahead probabilities estimated in the standard way Each parse returned by the parser was ... detransformed for evaluation The parser used in each trial was identical, with a base b e a m factor c~ = 10 -4 The performance is evaluated using these measures: (i) the percentage of candidate...
... Ample, close parking • Manageable packages • Assistance with carrying large purchases • Shade and shelter • Eliminate congested areas • Accessible forthe elderly • Tasty breakfast with a place ... shows and health fairs—don’t forget to have flyers about the upcoming season to hand out •Enter a market theme float in parades •Create a produce display forthe county fair •Offer to read an agriculture-themed ... reporters, the market can save the day when news and story ideas are slim If attendance at your market is sizable, local businesses should appreciate the traffic you bring to the area Considering approaching...
... 4646±4651 Nakayama, M., Masuda, T., Bando, T., Yamagata, H., Ohta, H & Takamiya, K (1998) Cloning and expression of the soybean chlH gene encoding a subunit of Mg-chelatase and localization of the Mg2+ ... synthase activity as a marker of envelope membranes and to chlorophyll concentration as a marker of thylakoids (B) Analysis of A thaliana chloroplast envelope and thylakoids fractions MgPIXMT activity ... chloroplast membranes (A) Analysis of spinach chloroplast envelope and thylakoids fractions The fractions were analyzed by SDS/PAGE and Coomassie blue staining and MgPIXMT activity was compared...
... vehicles, and others use them as the basis for their own in-house engine oil specifications Mobil products carry ACEA claims and you can refer to your owner’s manual to check whether these standards are ... McLaren team is, on the surface at least, simple Formula One cars are among the most technically demanding vehicles on the planet, providing an advanced and exacting test bed to develop lube and fuel ... looking fora high performance oil that would deliver long lasting protection forthe advanced turbocharged engine, Mobil was a natural fit because of its proven performance, andthe long track record...
... receiver near the end of his career (Paul Warfield), anda dominant running back (Larry Csonka) is a partial indicator that Miami wasn’t quite as strong as the other dynasty candidates of that era Add ... tackle can lose a team as many games as a great pass rusher can win That poor tackle play can hurt a team really isn’t a compelling argument forthe position’s value, because bad players at any ... affect the dynastic candidate’s competition if they don’t manage greed and inflated player value well Having said that, I have a theory as to why the NFL always has dynastic teams I believe that a...
... (possessor) danh từ người Sở hữu chủ danh từ đứng (là the boy” the boy’s new shirt”) Cách hình thành sở hữu cách ta thêm ’s vào sau sở hữu chủ danh từ số ít, danh từ theo sau ’s mạo từ (eg: the boy’s ... khác với “of” (eg: the boy’room = the room of the boy) the boy” câu cậu bé ấy, danh từ (noun) “boy” với mạo từ xác định (definite article) the cho biết danh từ xác định, có ngh a người nói người ... “new shirt” cụm danh từ - áo sơ mi mới, tính từ “new” có ngh a “mới” dùng để bổ ngh a cho danh từ “shirt” – áo sơ mi Cụm sở hữu cách the boy’s new shirt” = the new shirt of the boy” - “is” động...
... that other half Adding the parthuman factor to a monster helps the audience feel as if this, too, could happen to them, and it makes them empathetic It makes the creature both fantastic and tragic, ... wicked and fantastic that your characters andthe audience admire it andits special abilities Your monster must have strength of epic proportions, have the ability to break the laws of reality, ... putting their audience in the hands of a maniac In 1963, in Ireland, B-movie legend Roger Corman was making the film THE YOUNG RACERS (1963) At the time, a young Francis Ford Coppola, the multiple Academy...
... grammatical letter strings in an encoding phase and then assessed grammaticality and liking ratings for both grammatical and ungrammatical items at test In all three experiments, there was a ... state grammar During a learning phase, participants were exposed to grammatical tone sequences During the test phase, they were given old grammatical, novel grammatical, and novel ungrammatical ... prototypicality, two popular techniques in art are exaggeration and abstraction (Ramachandran & Hirstein, 1999) A perceptual fluency theory may again shed light on this paradox On the one hand, prototypical...
... except that lane is a sample spiked with c-3FLAG standard indicated by the arrow marked ‘c std’ Lane 2, lysate sample alone Note that a separation between c-3FLAG standard and e-CTF-3FLAG was achieved ... 5¢-GGGGGGCCAT GGCGACAGTGATCGTC-3¢; reverse, 3FLAG HindIII creating the plasmid c-3FLAG standard Finally, the primer pairs forward, 5¢-GGGGGGCCATGGTGATGCTGA AGAAGAACAG-3¢ and reverse 3FLAG HindIII were ... C101-3FLAG, c-3FLAG and e-3FLAG standards as molecular mass markers, the FLAG-reactive band migrating below C101-3FLAG is calculated to be a protein resulting from the expected a- secretase cleavage...
... tell his mother what he had done andthe patient was found later dead on the floor from having had slashed his own throat McMurphy never did leave and he was given a form of therapy called ECT, ... convulsions are produced This application of current induces unconsciousness so it becomes nearly impossible forthe patients to recall the treatment The patients are given a sedative beforehand and are ... electro-convulsive therapy, and after many sessions this left him in a nearcomatose state One night, Chief had killed McMurphy out of pity for him as he thought it was undignified that they had taken nearly all...
... mass and on the force applied to it The greater the force, the greater the acceleration The greater the mass, the lower the acceleration Or, mathematically, force = mass × acceleration A good way ... Ea for reverse reaction products The activation energies (Ea) forthe forward reaction (reactants forming products) andforthe reverse reaction (products forming reactants) are about the same ... one valley to the other (one valley representing the reactants, andthe other the products) The catalyst acts by making the hill lower reactants Ea with a catalyst reactants A catalyst acts by...
... Mamma was married to papa, Cousin Verotchka to Pavel Andreyitch But one might be married to papa and Pavel Andreyitch after all: they have gold watch-chains and nice suits, their boots are always ... hand and foot Kill the baby and then sleep, sleep, sleep Laughing and winking and shaking her fingers at the green patch, Varka steals up to the cradle and bends over the baby When she has ... bewitched." Varka takes the baby, puts him in the cradle and begins rocking it again The green patch andthe shadows gradually disappear, and now there is nothing to force itself on her eyes and cloud...
... phosphatase (APAAP) method (see later) Immunohistochemical double-labeling (APAAP method) Double-labeling was performed using the APAAP method, with monoclonal antibody against CD68 (macrophages ... normal lung parenchymal cells and is upregulated in lung tissue of WG patients PR-3 mRNA may therefore contribute to lung damage in WG and other ANCA-associated diseases via direct interaction ... The expected size of the fragment was 500 base pairs The cDNA fragment was extracted and purified from a preparative gel using the Wizard PCR preps DNA purification system (Promega A 7170, CA,...
... Image 1.62, andthe percentage of disc staining positive for GAGs was calculated from the ratio of the stained area to the total area in each section The average of the 10 values for each half ... articular cartilage, the joint was shaved, the articular surfaces were exposed, andthe cartilage was scraped from the articular surfaces of the femur and tibia and incubated in PBS with antibiotic ... with a software program that automatically outlined the total and Safranin-O-stained areas with threshold settings (Photoshop 4.0; Adobe, San Jose, California, USA) These areas were then quantified...
... expressed as an increase in normalized values over that observed with untreated cells Amplification primers forthe human genes were as follows: BAFF, 5'-TGAAACACCAACTATACAAAAAG-3' and 5'-TCAATTCATCCCCAAAGACAT3'; ... design and drafting of the manuscript JEG performed statistical analysis and participated in the study design and drafting of the manuscript FL and JS participated in the study design and drafting ... Rheumatol 2001, 13:370-376 Matsumura R, Umemiya K, Goto T, Nakazawa T, Kagami M, Tomioka H, Tanabe E, Sugiyama T, Sueishi M: Glandular and extrag- Available online http://arthritis-research.com/content/8/2/R51...
... 2005, 1:10 They have to accommodate and influence the disparate agendas of multiple partners For instance, the International AIDS Vaccine Initiative (IAVI) has 25 partners and operations in 22 ... Priorities for HIV/AIDS management to IPR, cheap generics will continue to dominate these potentially large and lucrative markets of the future the Malaria Vaccine Initiative andthe Medicines for Malaria ... account for 77% of the market although they account for less than 15% of the global population [3] In contrast, Sub-Saharan Africa that accounts for almost 25% of the global burden (measured in DALYs)...