the importance of organic nitrogen production in aquatic systems a landscape perspective

Tài liệu Health Education in Schools – The Importance of Establishing Healthy Behaviors in our Nation’s Youth pptx

Tài liệu Health Education in Schools – The Importance of Establishing Healthy Behaviors in our Nation’s Youth pptx

Ngày tải lên : 14/02/2014, 13:20
... statistics are alarming and disturbing for the health of the nation The good news is that research has revealed that health risk behaviors that contribute to the leading causes of death in the ... delay the onset of the leading causes of death in our country.30 New evaluation of health education research shows promise of having a positive impact on academic achievement as it has on health ... Responsibility to Address Quality and Quantity of School Health Education The American Cancer Society, the American Diabetes Association, and the American Health Association encourage quality school health...
  • 5
  • 460
  • 0
The Sustainability of Organic Grain Production on the Canadian Prairies—A Review doc

The Sustainability of Organic Grain Production on the Canadian Prairies—A Review doc

Ngày tải lên : 14/03/2014, 20:20
... only a few studies have examined the potential impacts of organic systems on the Canadian prairies Modeling of a hypothetical transition to organic production in Canada suggested that a total transition ... that such an integrated approach may be key to the longterm sustainability of organic grain production on the Canadian Prairies [73] Environmental Aspects of Organic Grain Production on the Canadian ... certified organic farms, representing 1.5% of all farms in Canada [6] Nearly half (45%) of these farms are situated in the Prairie Provinces, with Saskatchewan accounting for about one-third of the nationwide...
  • 19
  • 701
  • 0
Health Education in Schools – The Importance of Establishing Healthy Behaviors in our Nation’s Youth pptx

Health Education in Schools – The Importance of Establishing Healthy Behaviors in our Nation’s Youth pptx

Ngày tải lên : 22/03/2014, 15:21
... statistics are alarming and disturbing for the health of the nation The good news is that research has revealed that health risk behaviors that contribute to the leading causes of death in the ... delay the onset of the leading causes of death in our country.30 New evaluation of health education research shows promise of having a positive impact on academic achievement as it has on health ... Responsibility to Address Quality and Quantity of School Health Education The American Cancer Society, the American Diabetes Association, and the American Heart Association encourage quality school health...
  • 5
  • 566
  • 0
Báo cáo khoa học: Complement factor 5a receptor chimeras reveal the importance of lipid-facing residues in transport competence doc

Báo cáo khoa học: Complement factor 5a receptor chimeras reveal the importance of lipid-facing residues in transport competence doc

Ngày tải lên : 23/03/2014, 04:21
... contain a carboxy-terminal YFP and an A6 6C substitution in the first intracellular loop and a C144S mutation in the second intracellular loop These mutations have no impact on the function of C5aR ... protein for each data point After the membranes were thawed on ice, the protein concentration was determined using BSA as standard The binding reaction was set up using the Binding Buffer (Hanks ... for assembling the TM bundle for C5aR was the X-ray structure of darkadapted rhodopsin (Protein Databank entry: 1F88, chain A) At the stage of helical packing, the dihedral angles F and W were...
  • 15
  • 365
  • 0
Báo cáo y học: "The importance of measuring psychosocial functioning in schizophrenia" pps

Báo cáo y học: "The importance of measuring psychosocial functioning in schizophrenia" pps

Ngày tải lên : 09/08/2014, 01:21
... consultant for Angelini Pharmaceutical Portugal, and has received educational grants from Lundbeck, Sanofi-Aventis, JanssenCilag and AstraZeneca MLF is a full professor of Psychiatry and Head of the ... search, and wrote the first draft of the manuscript The data were analysed by SB, VVD, AM and MLF, who wrote the final draft of the manuscript All authors contributed to and approved the final ... and acceptance over time [6] A major issue remains the lack of consensus concerning the definition and evaluation of social functioning This in part appears to be related to the lack of distinction...
  • 7
  • 539
  • 0
Báo cáo y học: "The importance of localizing pulmonary veins in atrial septal defect closure" ppsx

Báo cáo y học: "The importance of localizing pulmonary veins in atrial septal defect closure" ppsx

Ngày tải lên : 10/08/2014, 09:21
... includes transfer of the anomalous pulmonary vein to the right atrium adjacent to the ASD and then baffling its flow across towards the left atrium [5] Several other congenital anomalies are also reported ... operation in light of possible pulmonary necrosis and infection In the end a pericardial patch was used to close the ASD and as an intraatrial baffle to direct flow from the anastomosed pulmonary vein ... contributed to the patient’s care AR interpreted radiographic images All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests...
  • 3
  • 417
  • 0
THE IMPORTANCE OF AN ALLOSTERIC POCKET IN THE DENGUE PROTEASE

THE IMPORTANCE OF AN ALLOSTERIC POCKET IN THE DENGUE PROTEASE

Ngày tải lên : 02/10/2015, 17:13
... D2NS3_I16 5A_ FOR D2NS3_I16 5A- REV CCAAACAAAACCTGGTCTTTTCAAAAGCAACGCC GGAACC GGTTCCGGCGTTGCTTTTGAAAAGACCAGGTTTT GTTTGG GCATATGTGAGTGCTGCAGCCCAGACTGAAAAAA GTATTG CAATACTTTTTTCAGTCTGGGCTGCAGCACTCAC ATATGC ... CACAGTTGATGATGATGGAACATTCAGAATAAAAG ATGATG CATCATCTTTTATTCTGAATGTTCCATCATCATCA ACTGTG D3NS2B_M084F_REV D3NS3_T118S_FOR D3NS3_T118S_REV CAGGCACTTTTCAGTCTACCACAGGGGAAATAG CTATTTCCCCTGTGGTAGACTGAAAAGTGCCTG ... GTTCCATCATCATCAGCTGTGATCATTAAGTTGTG D3NS2B_M08 4A_ FOR CACAGTTGATGATGATGGAACAGCGAGAATAAAAG ATGATG CATCATCTTTTATTCTCGCTGTTCCATCATCATCA ACTGTG D3NS2B_M08 4A_ REV D3NS3_W08 9A_ FOR D3NS3_W08 9A_ REV GGAGACTGAGCGCACAAGCGCAGAAGGGGGAG...
  • 109
  • 316
  • 0
596 THE USE OF RELATIONSHIP MARKETING TECHNIQUES IN HIGHER EDUCATION  A CASE STUDY

596 THE USE OF RELATIONSHIP MARKETING TECHNIQUES IN HIGHER EDUCATION A CASE STUDY

Ngày tải lên : 08/04/2013, 17:02
... Dalat 2.2.2 Chức năng, hiệu suất Marketing du lịch Dalat: Stephan Haeckel, giám đốc Viện Kinh doanh IBM, quan niệm “tương lai Marketing “một” chức doanh nghiệp, mà “cái” chức doanh nghiệp” Marketing ... Nam gần n a kỷ qua, vùng rau hoa lớn nước khu vực Dalat sản xuất 100.000 rau loại cung cấp cho thị trường Hồ Chí Minh, tỉnh ph a Nam, miền Trung xuất sang Nhật Bản, Đài Loan, Hồng Công, Singapore ... Các sở, ngành có liên quan tỉnh doanh nghiệp tập trung đầu tư nâng cấp khu nghỉ dưỡng đ a bàn, bật khu resort Hoàng Anh - Dalat, khu nghỉ mát resort Anna Mandara Villas Dalat, khu biệt thự Trần...
  • 162
  • 1.1K
  • 2
the relationship between corporate culture and the use of management accounting innovations in vietnamese companies  a study of techcombank

the relationship between corporate culture and the use of management accounting innovations in vietnamese companies a study of techcombank

Ngày tải lên : 13/03/2014, 14:20
... 42  Another finding of the survey is the opinions of asked accountants and managers about the practice of four initiative methods of the application of managerial accounting in Techcombank The ... have an effect on competitive advantages of an organization when taking part in the international marketplace 2.2 Overview of the innovation of management accounting 2.2.1 Definition of management ... have that focus on the innovative management accounting practices to eliminate the redundant accounting practices and encourage a more dynamic and initiative approach to managerial accounting For...
  • 86
  • 898
  • 0
báo cáo sinh học:" Human resources and the quality of emergency obstetric care in developing countries: a systematic review of the literature" potx

báo cáo sinh học:" Human resources and the quality of emergency obstetric care in developing countries: a systematic review of the literature" potx

Ngày tải lên : 18/06/2014, 17:20
... remainder of the analysis was carried out using the data extraction form and the analytical framework presented in the following section Analytical framework The concept of "quality of care" was defined ... affect the availability of HR for EmOC They point out that these staff shortages weaken the quality of care by increasing professionals' workloads and patients' waiting times and making infection ... performance Variations in their quality are rapidly expressed as changes in measurable outcomes such as maternal and infant mortality Moreover, the technical nature of EmOC and the necessary interaction...
  • 12
  • 640
  • 0
Fibroblast-like synovial cells from normal and inflamed knee joints differently affect the expression of pain-related receptors in sensory neurones: a co-culture study ppsx

Fibroblast-like synovial cells from normal and inflamed knee joints differently affect the expression of pain-related receptors in sensory neurones: a co-culture study ppsx

Ngày tải lên : 09/08/2014, 10:20
... from rats days (acute phase) or 20 to 28 days (chronic phase of inflammation) after induction of AIA The patella and the menisci of the joints with adjacent synovial tissue were separated and cultured ... inhibitor indomethacin to the co-culture Together, these data indicate a crucial role of prostaglandins in NK1 receptor upregulation at the acute stage of inflammation However, this explanation is ... cervical dislocation during ether anaesthesia In total, 17 untreated rats of the same age and sex were used as normal control animals All rats were used for the preparation of FLS cells All procedures...
  • 12
  • 184
  • 0
A work force model to support the adoption of best practice care in chronic diseases – a missing piece in clinical guideline implementation pot

A work force model to support the adoption of best practice care in chronic diseases – a missing piece in clinical guideline implementation pot

Ngày tải lên : 11/08/2014, 05:21
... knowledge of clinical practice guideline by clinicians This requires that guidelines are written in a way that is clear to clinicians and translatable into actions and an effective dissemination strategy ... Morbidity and Mortality National Death Index, Burden of Disease Studies[44] Regular surveys National Health Survey, ABS Cause of Death statistics etc Administrative data sets Hospital data bases Inpatient ... Council of Australia (NHMRC): A guide to the development, evaluation and implementation of clinical practice guidelines Canberra: Commonwealth of Australia; 1999 26 27 National Institute of Clinical...
  • 9
  • 486
  • 0
Báo cáo y học: "Investigating the complementary value of discrete choice experiments for the evaluation of barriers and facilitators in implementation research: a questionnaire survey" pptx

Báo cáo y học: "Investigating the complementary value of discrete choice experiments for the evaluation of barriers and facilitators in implementation research: a questionnaire survey" pptx

Ngày tải lên : 11/08/2014, 05:21
... paper was part of a larger research project entitled 'Investigating the added value of conjoint analysis for the evaluation of barriers and facilitators in implementation studies: the case of ... conception and design of the study and planning of the work that led to the manuscript, the acquisition, and interpretation of data, and has been involved in drafting and critically revising the manuscript ... planning of the work that led to the manuscript, the acquisition, analysis and interpretation of data, and has been involved in drafting and critically revising the manuscript for important intellectual...
  • 12
  • 398
  • 1
báo cáo khoa học: " A work force model to support the adoption of best practice care in chronic diseases – a missing piece in clinical guideline implementation" ppt

báo cáo khoa học: " A work force model to support the adoption of best practice care in chronic diseases – a missing piece in clinical guideline implementation" ppt

Ngày tải lên : 11/08/2014, 16:21
... knowledge of clinical practice guideline by clinicians This requires that guidelines are written in a way that is clear to clinicians and translatable into actions and an effective dissemination strategy ... Morbidity and Mortality National Death Index, Burden of Disease Studies[44] Regular surveys National Health Survey, ABS Cause of Death statistics etc Administrative data sets Hospital data bases Inpatient ... Council of Australia (NHMRC): A guide to the development, evaluation and implementation of clinical practice guidelines Canberra: Commonwealth of Australia; 1999 26 27 National Institute of Clinical...
  • 9
  • 368
  • 0
báo cáo khoa học: " Investigating the complementary value of discrete choice experiments for the evaluation of barriers and facilitators in implementation research: a questionnaire survey" pot

báo cáo khoa học: " Investigating the complementary value of discrete choice experiments for the evaluation of barriers and facilitators in implementation research: a questionnaire survey" pot

Ngày tải lên : 11/08/2014, 16:21
... paper was part of a larger research project entitled 'Investigating the added value of conjoint analysis for the evaluation of barriers and facilitators in implementation studies: the case of ... conception and design of the study and planning of the work that led to the manuscript, the acquisition, and interpretation of data, and has been involved in drafting and critically revising the manuscript ... planning of the work that led to the manuscript, the acquisition, analysis and interpretation of data, and has been involved in drafting and critically revising the manuscript for important intellectual...
  • 12
  • 483
  • 0
báo cáo khoa học: " The rise of injecting drug use in east Africa: a case study from Kenya" ppsx

báo cáo khoa học: " The rise of injecting drug use in east Africa: a case study from Kenya" ppsx

Ngày tải lên : 11/08/2014, 20:20
... used and easily available in Nairobi and Tanzanian cities such as Zanzibar, Arusha and Dar es Salaam, than at the Kenyan Coast The recent study from Dar es Salaam, Tanzania [7] indicates that injecting ... island of Pemba than in Zanzibar town (the islands of Pemba and Unguja comprise Zanzibar, which is also the name of the main town on the island of Unguja) Heroin users at the Kenya Coast, as ... of heroin users within East Africa Indeed, many words, such as tapeli ('scam') seem to originate from mainstream Tanzanian dialects of Swahili and have been diffused into Kenyan drug slang Other...
  • 9
  • 319
  • 0
Báo cáo khoa học: "Efficiency of 7.2% hypertonic saline hydroxyethyl starch 200/0.5 versus mannitol 15% in the treatment of increased intracranial pressure in neurosurgical patients – a randomized clinical trial [ISRCTN62699180]" pptx

Báo cáo khoa học: "Efficiency of 7.2% hypertonic saline hydroxyethyl starch 200/0.5 versus mannitol 15% in the treatment of increased intracranial pressure in neurosurgical patients – a randomized clinical trial [ISRCTN62699180]" pptx

Ngày tải lên : 12/08/2014, 22:22
... have been only limited data available for comparison of these two osmotic agents in a clinical setting A small amount of evidence is available that hypertonic saline has some advantages compared ... Inc, Raynham, MA, USA) An increase in ICP was treated first by deepening the sedation and analgesia by titrating the medication and adjusting to adequate ventilator settings If ICP exceeded the ... Analgosedation and continuous patient monitoring were managed according to the standards of the Department of Anesthesiology and Critical Care at the Martin-Luther-University Halle-Wittenberg, Germany Analgosedation...
  • 11
  • 326
  • 0
Báo cáo y học: "The effectiveness of ENAR® for the treatment of chronic neck pain in Australian adults: a preliminary single-blind, randomised controlled trial" potx

Báo cáo y học: "The effectiveness of ENAR® for the treatment of chronic neck pain in Australian adults: a preliminary single-blind, randomised controlled trial" potx

Ngày tải lên : 13/08/2014, 14:20
... asian caucasian Total Frequency Valid who had a potential to interact with the trial participants Additional File outlines the flow of participants throughout the trial, including the intervals ... (COES®) – Repatriation Hospital 1996 using standard scoring algorithms and analysis of means and standard deviation in that program Table demonstrates the breakdown of participant race within the project ... that reported in the Australian 2001 Census data of people living in the same geographical area (Ryde, New South Wales) [14] Table indicates means and standard errors of (NDI) as a function of...
  • 11
  • 271
  • 0
Developing the business of commodity future contract at Techcombank - from a marketing perspective

Developing the business of commodity future contract at Techcombank - from a marketing perspective

Ngày tải lên : 26/03/2015, 08:45
... in investment and asset management areas Moreover, HSBC, one of the leading Bank in the world has become a strategic partner of Techcombank with 20% chartered Capital Looking ahead, Techcombank ... required the State Bank of Vietnam to tighten the monetary policy to dominate inflation This made interest increase, control the use of foreign currencies, continue to renovate the wage law, maintain ... under the strategic guidance and oversight of the Board of Directors as well as the Board of Management will give it competitive advantages Risk management is another matter that is receiving our...
  • 108
  • 432
  • 0