the gas chromatographic determination of a gasoline component by method of standard additions and an internal standard

A review on sample preparation and chromatographic determination of acephate and methamidophos in different samples

Ngày tải lên : 02/09/2015, 13:47

... et al (2006) Gas chromatography mass Human and animal urine Multiresidue including spectrometry acephate and methamidophos Hardt and Angerer Gas chromatography mass Human and animal urine Multiresidue ... aminotransferase, creatinine, urea, and gamma glutamyltransferase Tanaka et al (2005) Liquid chromatography Human serum Acephate and mass spectrometry pseudocholinesterase methamidophos Ueyama et al ... revealed that acephate and methamidophos can persist on soils (Zhang et al., 2005; Battu et al., 2009), fruits and vegetables (Antonious and Snyder, 1994; Bouchard and Lavy, 1982; Chuanjiang et al.,...

8
428
0

Báo cáo Y học: A comparison of the urea-induced unfolding of apo¯avodoxin and ¯avodoxin from Desulfovibrio vulgaris potx

Ngày tải lên : 31/03/2014, 15:20

... constant, aL is the mean activity of the salt, and LU and LF are the number of salt ions bound by the unfolded and folded states of the apoprotein, respectively Determination of kinetic and thermodynamic ... respectively, and F and U are the proportions of the folded and unfolded states; R is the gas constant; and T is the temperature in K The urea-unfolding curves for ¯avodoxin and apo¯avodoxin were analysed ... the protein from D desulfuricans [10] MATERIALS AND METHODS Preparation and estimation of ¯avodoxin and apo¯avodoxin Flavodoxin from D vulgaris was obtained as the recombinant protein that was...

12
537
0

$Báo cáo khoa học: "Morphometric and histopathological studies on the effects of some chromatographic fractions of Phyllanthus amarus and Euphorbia hirta on the male reproductive organs of rats" potx$

Báo cáo khoa học: "Morphometric and histopathological studies on the effects of some chromatographic fractions of Phyllanthus amarus and Euphorbia hirta on the male reproductive organs of rats" potx

Ngày tải lên : 07/08/2014, 17:22

5
311
0

Báo cáo khoa học: "The influences of age, extractive content and soil water on wood color in oak: the possible genetic determination of wood color" pptx

Ngày tải lên : 08/08/2014, 19:21

... species’ mean values of a* , b* and C* were very small and were not significant On the average, there was some suggestion that the wood of sessile oak is slightly lighter than that of pedunculate oak ... INTRODUCTION d’Amance, near Nancy Three species (Q robur, Q petraea and Fagus sylvatica) from 99 plots were The color of wood is an important quality criterion and is often the decisive one ... towards the pith All color parameters were significantly related to tree age (see table II; figs and 4) The relationships are particularly strong for hue h* and the green-red axis a* It was found...

7
252
0

Báo cáo khoa học: " A conserved predicted pseudoknot in the NS2A-encoding sequence of West Nile and Japanese encephalitis flaviviruses suggests NS1'''' may derive from ribosomal frameshifting" ppt

Ngày tải lên : 12/08/2014, 04:21

... has demonstrated that, at least in Dengue virus, cleavage at the non -standard NS1-NS 2A cleavage site requires translation of substantial (Ŭ amino acids) parts of NS 2A [1012] Thus NS 2AN- FOO is likely ... Both authors edited and approved the final manuscript Acknowledgements This work was supported by an award from Science Foundation Ireland and by NIH Grant R01 GM079523, both to JFA Page of (page ... CAGCUGGGCCUUCUGGUGAUGUUUCUGGCCACCCAGGAGGUCCUUCGCAAGAGGUGGACGGCCAGAUUGACC NC_006551 U CCU UUU CAGUUGGGCCUUCUGGUGAUGUUUCUGGCCACCCAGGAGGUCCUGAGGAAGAGGUGGACGGCCAGAUUGACU NC_000943 U CCU UUU CAGUUAGGCCUUCUGGUGAUGUUUCUGGCCACCCAGGAGGUCUUGAGGAAGAGGUGGACGGCCAGACUUACU...

6
358
0

Báo cáo y học: "The Utstein template for uniform reporting of data following major trauma: A joint revision by SCANTEM, TARN, DGU-TR and RITG" ppt

Ngày tải lên : 13/08/2014, 23:20

... on Scandinavian MTOS and Trauma Registry: Feasibility of comparing core data from existing trauma registries in Scandinavia Reaching for a Scandinavian major trauma outcome study (MTOS) Scand ... LH, PAS and HML wrote the article The rest of the panellists read the manuscript once, made comments to it and approved the manuscript All authors read and approved the final version of the manuscript ... criteria and data points from the European Trauma Audit & Research Network The Swedish Trauma Registry Standard (KVITTRA), Data Dictionary The Norwegian National Trauma Registry, Data Dictionary American...

19
340
0

Liquid phase microextraction for the determination of acidic drugs and beta blockers in water samples

Ngày tải lên : 10/11/2015, 11:00

... volume of donor phase, organic phase and acceptor phase are V aq1, V org and V aq2, and initial concentration of analyte is [A] aq1,i , the mass balance relationship for analyte A at equilibrium can ... for the analyte A, DA1, between the organic and donor phase is given by D A1 = [ A] org [ A] aq1 (2.7) and the distribution ratio for the analyte A, DA2, between the organic and acceptor phase ... substituting [A] aq1 from (2.7) and [A] org from (2.8), and rearranging the above equation, [ A] aq1,i = = [ A] org [ A] org Vorg [ A] aq 2Vaq + + DA1 Vaq1 Vaq1 DA [ A] aq DA1 + DA [ A] aq 2Vorg Vaq1 + [ A] aq...

74
277
0

The aspectual make up of Perfect participles and the interpretations of the Perfect- Roumyana Pancheva

Ngày tải lên : 18/10/2013, 14:15

... pjasâc!na kula i predi Ivan is build-NEUT sand castle and before ‘Ivan has built a sandcastle before as well.’ d * Ivan e stroil pjasâc!na kula sega Ivan is build-NEUT sand castle now ‘Ivan has ... build-NEUT.M.SG sand ‘Ivan has been building a sandcastle.’ b Ivan e strojal pjasâc!na Ivan be-3SG.PRES build-IMPERF.M.SG sand ‘Ivan has been building a sandcastle.’ c Ivan e postroil pjasâc!na Ivan be-3SG.PRES ... pjasâc!nata Ivan be-3SG.PRES build-M.SG.ACTIVE sand -the ‘Ivan has built the sandcastle.’ b Pjasâc!nata kula e postroena sand -the castle be-3SG.PRES build-F.SG.PASS The sandcastle is built by...

33
536
0

Tài liệu Health of Children Living in Urban Slums in Asia and the Near East: Review of Existing Literature and Data pdf

Ngày tải lên : 12/02/2014, 12:20

... Cities”: a comparative analysis of mortality, morbidity, and malnutrition rates in the three selected countries and cities, and a comparative analysis among urban, urban poor, and rural manifestations ... UNICEF also presents national child health data broken down as “urban” and “rural.” When comparing urban and rural data, the health status of urban children appears relatively good; urban infant and ... municipal health, water and sewer services, and infrastructure and thus has a higher standard of health and welfare The data would seem to bear out these assumptions For understanding the health status...

104
1.5K
0

Tài liệu Báo cáo khoa học: Glycation of low-density lipoprotein results in the time-dependent accumulation of cholesteryl esters and apolipoprotein B-100 protein in primary human monocyte-derived macrophages docx

Ngày tải lên : 19/02/2014, 02:20

... Thornalley PJ, Battah S, Ahmed N, Karachalias N, Agalou S & Babaei-Jadidi R (2003) Quantitative screening of advanced glycation endproducts in cellular and extracellular proteins by tandem mass ... using the bicinchoninic acid assay (Pierce, Rockford, IL, USA) with 60 of incubation at 60 °C, using BSA as a standard Data analysis Data are expressed as mean ± SEM from three or more separate ... turnover of the apoB protein It is shown that both lipid and protein are taken up, in a time-dependent manner, via scavenger receptor SR -A- and CD36-mediated processes, and that the uptake of lipid and...

12
604
0

The Classification of Pulmonary Tuberculosis and An Outline of Standardised Principles of Management pot

Ngày tải lên : 06/03/2014, 04:20

... primary and secondary types and the four main forms of the disease In the management and rehabilitation of a case, and especially in epidemiological work physiological and accidental factors play ... Management of tuberculosis, as employed to-day, is largely empirical, and a physician is greatly handicapped by the absence of standardised methods of approach, based logically on fundamental ... If the fundamental principles of pathogenesis are understood and a ‘complete diagnosis’ is made on the basis of type and form of the disease as well as extent and activity, then management can...

14
497
0

Báo cáo khoa học: Halogenated benzimidazoles and benzotriazoles as inhibitors of the NTPase/helicase activities of hepatitis C and related viruses ppt

Ngày tải lên : 08/03/2014, 02:20

... properties of TBBT, and a number of related benzotriazoles and benzimidazoles, at the NTPase/helicase sites of HCV and the related viruses Japanese encephalitis virus (JEV) and WNV, as well as the human ... analysis using ENZFITTER (BioSoft) and SIGMA PLOT (Jandel Corp.) ATPase and helicase assays Fig SDS/PAGE analysis of the NTPase/helicases used in this study Aliquots of the ﬁnal preparation of ... reaction was then initiated by addition of MgCl2, ATP, BSA and DNA or RNA substrate at concentrations used in the standard helicase assay ATP hydrolysis was started by the addition of MgCl2, ATP...

9
659
0

THE BUFFETT REPORT The Nine Investing Secrets of Warren Buffett —and how to profit from them pot

Ngày tải lên : 14/03/2014, 19:20

... USA and ARB and Harvey Norman in Australia.2 Discover some of the common sense tests for determining the financial health of thousands of listed companies in Australia, Canada and the USA Learn ... fact, the above two graphs of the same company, ARB Corporation This is an Australian company that manufactures and supplies equipment for off-road and four-wheel drive vehicles around the world The ... greater transaction costs and taxes) All of which is futile Or worse still, erodes capital even faster The Secrets Of The World’s Greatest Money Manager As a professor of mathematics and finance...

31
908
0

Rembrandt's Reading: The Artist's Bookshelf of Ancient Poetry and History

Ngày tải lên : 17/03/2014, 18:19

... Dutch and German during the Renaissance Eric Jan Sluijter and Lisa Vergara read portions of this material in early phases, and J Michael Montias read the manuscript in a later stage; they offered ... His acquaintances in Leiden, Amsterdam, and The Hague were literate if not erudite, and many were poets and scholars A few of these had substantial libraries and art collections, to which Rembrandt ... poetry, and manners manuals He read Karel van Mander 32 rembrandt ’ s reading on painting, and Ronsard’s poetry On January 20, he purchased a French Bible, and wrote that he spent many evenings reading...

283
516
0

Measuring the long-term perception of monetary policy and the term structure docx

Ngày tải lên : 22/03/2014, 23:20

... the sample, they test for a change in the constant parameter in (4.2), the other parameters remaining constant We then focus on the ave-Wald version of the Andrews (1993) and Andrews and Ploberger ... Kozicki and Tinsley (200 1a) , Evans and Lewis (1995) and Crowder and Ho¤man (1996) have proposed di¤erent estimates of the magnitude of the marginal tax rate for the United States It appears that this ... 1998 (and normally depended of German macroeconomic conditions) and of the ECB after this date (and the euro area activity and in‡ ation)? This question is important not only on a theoretical basis...

46
392
0

Public risk for private gain? The public audit implications of risk transfer and private finance pptx

Ngày tải lên : 23/03/2014, 04:20

... revision and financial restructuring The expectation that changes in risk transfer are accompanied by changes in the premiums paid to private financiers and adjustments to annual payments has not ... by government and BAA plc, and the banks accepted a drop in their margins and fees.98 The main risks in the original NATS PPP were demand, credit and insolvency risk There is no baseline data ... the charge made for capital in a PFI deal and it is set at a level sufficient to pay back the principal and interest of all loans and the dividends of shareholders over the life of the contract...

46
364
0

Báo cáo Y học: The C-terminal domain of perfringolysin O is an essential cholesterol-binding unit targeting to cholesterol-rich microdomains pptx

Ngày tải lên : 23/03/2014, 21:20

... 5¢-CTCAGGC TAGCAAGGGAAAAATAAACTTAGATC-3¢ (for D4 and DC-D4), 5¢-TCAGAGCTAGCAGTGGAGCCTATG TTGCACAG-3¢ (for DN-D4) and 5¢-TGGTGGTGG TGCTCGAGTGC-3¢ For the construction of a plasmid encoding a His-tag-EGFP-D4 ... of kinetic analysis by the BIAcore systems We thank Drs Yoshitaka Nagai and Koichi Suzuki for support and encouragement We are grateful to Drs Inomata and Hayashi for technical advice and to Dr ... supernatant (S) and pellet (P) fractions were separated and analyzed by SDS/PAGE followed by immunoblotting with an antibody against h-toxin C-terminal peptide Lane M shows molecular size marker...

9
465
0

The Exchange Rate Exposure of U.S. and Japanese Banking Institutions potx

Ngày tải lên : 29/03/2014, 13:20

... Bank of San Francisco and Ernst and Young of San Jose for research support We also thank Elizabeth Laderman and Mark Levonian for their thoughtful comments Finally, we are grateful to Barbara ... See Table 29 Appendix B Japanese Banks Included in the Sample Akita Aomori Asahi Ashikaga Awa Fukuoka Ikeda Iwate Kansai Kinki Kyoto Nagoya Okinawa Osaka Saga Theryukyus Tokyo Yokohama Biwako ... M and William M Gentry 1993 “Exchange Rate Exposure and Industry Characteristics: Evidence from Canada, Japan, and the USA” Journal of International Money and Finance, 12 Campbell, John Y and...

37
328
0

Culture and Aesthetic Preference: Comparing the Attention to Context of East Asians and Americans pptx

Ngày tải lên : 30/03/2014, 16:20

... from each Method Participants Fifty-two Americans at the University of Michigan, Ann Arbor (50 Westerners and Asian Americans; 27 females and 23 males) and 48 Japanese at Kyoto University, Japan ... amount of information on the home page of governmental institutions in East Asia (China, Japan, and Korea) and North America (Canada and United States) They observed that East Asian– made home pages ... (22 females and 26 males), participated in the experiment Masuda et al / CULTURE AND AESTHETIC PREFERENCE 1267 Figure Example of landscape pictures drawn by American and East Asian participants...

16
711
0

Báo cáo khoa học: The isopenicillin N acyltransferases of Aspergillus nidulans and Penicillium chrysogenum differ in their ability to maintain the 40-kDa ab heterodimer in an undissociated form pdf

Ngày tải lên : 31/03/2014, 01:20

... of the molecular mass markers in kDa is shown on the left The immunoreactive IAT bands of 40 kDa, 29 kDa and 11 kDa are indicated by arrows on the right Note the presence of the 40-kDa band and ... protein and the lack of processing to the 29-kDa and 11-kDa subunits) in lane 4; lane 5, molecular mass markers; lanes and 7, control E coli [pT7-7] without and with induction; lanes and 9, E ... npe8 and P chrysogenum npe6 transformants with the penDE gene of A nidulans (molecular mass 40 kDa) Ribonuclease A (RA), chymotrypsinogen A (ChT), ovalbumin (OA), and BSA were used as standards All...

11
423
0