the formation of volcanoes at convergent plate boundaries

Báo cáo Y học: The presence of phosphate at a catalytic site suppresses the formation of the MgADP-inhibited form of F1-ATPase potx

Ngày tải lên : 24/03/2014, 00:21

... conclude that the presence of Pi at a catalytic site interferes with the formation of the MgADP- 58 N Mitome et al (Eur J Biochem 269) Fig Fluorescence titration of the catalytic sites of the a(W463F)3b(E190Q/Y341W)3c ... MgATP with and without phosphate (A) Time course of MgATP binding in the presence of 10 mM phosphate The indicated concentrations of MgATP were added at s (B) Time course of MgATP binding in the ... When MgATP was lower or higher than 200 nM, the MgATP binding was fast (Fig 5A,C) At lM, the rate of MgATP binding in the presence of Pi was faster than at 300 nM This increase in the rate of ATP...

8
443
0

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Ngày tải lên : 18/02/2014, 08:20

... intermediates, and the sequence in which these putative sub-complexes bind to each other during the assembly of the bc1 complex is also unknown Furthermore, as in the case of the biogenesis of other ... demonstrated, the incorporation of all the other subunits into the bc1 core structure proceeds normally, thus leading to the formation of the bc1-oxidase supercomplexes [12] On the other hand, ... Taken together, these ﬁndings indicate that: (a) Qcr6p is not required for the formation and stabilization of the 500 kDa bc1 subcomplex and (b) Qcr6p is not required for the incorporation of Qcr9p...

15
639
0

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Ngày tải lên : 19/02/2014, 17:20

... (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... minute The relative values of simultaneous modulation of the three las enzymes are calculated as the average of the three individual relative activities Construction of strains with modulated expression ... and show that the data fit well with the individual determination of flux control coefficients by PFK, PK and LDH The role of the las operon is discussed on the basis of the distribution of flux control...

12
616
0

Tài liệu The Formation of Christendom, Volume VI pdf

Ngày tải lên : 21/02/2014, 11:20

... the Saviour with the guardianship of the Vine" But the Vine in the universal language of the Fathers betokened the whole Church of God And the Council refers the confirmation of its acts to the ... appointment of the Saviour Himself The words, then, of the Council contain a special acknowledgment that the line of Popes after a succession of four hundred years sat in the person of Leo on the seat of ... persons in the eyes of the world without amounts to this, that by denying the Primacy they disprove the existence of the Church Their negation goes to the profit of total unbelief Asserters of the Church's...

168
375
0

Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx

Ngày tải lên : 21/02/2014, 15:20

... overexpressed in human 293-cells The main objective of the present work was to find an explanation for this phenomenon It is demonstrated that the formation of the active complex is profoundly influenced by ... shown) Investigation of the cell lysate by gel filtration demonstrated that a substantial part of the immunoreactive protein from the extract of an individual clone with a high expression of human TPP ... located in the insert within the catalytic domain, close to the catalytic His264, and the proximity to the active site may explain the effect of oligomerization on enzyme activity Even though the...

6
520
0

Báo cáo khoa học: Protein aggregation and amyloid ﬁbril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot

Ngày tải lên : 06/03/2014, 00:20

... representing most of the above-mentioned categories These amyloidogenic determinants may often act as ‘conformational switches’ and thus they may play the role of templates initiating amyloid formation, ... hot-spot, the area of the aggregation profile above the HST, the total area (the HST being the zero axis) and the area above the HST of each profile peak identified as a hot-spot These areas are calculated ... as the average of the a3v of the 20 natural amino acids weighted by their frequencies in the SwissProt database [22] A segment of the polypeptide sequence is considered as a putative aggregation...

8
415
0

Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc

Ngày tải lên : 08/03/2014, 08:20

... the synthesis of androstadienol diverges from the biosynthetic pathway of sex steroids at the level of preg transformation and that it does not involve the 17a-hydroxylase activity Furthermore, ... prior formation of 17a-OH-preg and DHEA The lack of androstadienol synthesis in the presence of lM of ketoconazole (C), an inhibitor of cytochrome Fig Thin layer chromatography showing the transformation ... molybdate/sulfuric acid (10 : 10, v/v) P450, further demonstrates the speciﬁc implication of P450c17 in the formation of this metabolite Formation of androstadienol by human and porcine P450c17,...

7
612
0

Báo cáo Y học: Introducing Wilson disease mutations into the zinc-transporting P-type ATPase ofEscherichia coli The mutation P634L in theÔhingeÕ motif (GDGXNDXP) perturbs the formation of the E2P state pdf

Ngày tải lên : 17/03/2014, 17:20

... measuring the formation of aspartyl phosphate, the catalytic cycle of a P-type ATPase can be characterized by determining the decay rate of the phosphorylated intermediate The aspartyl-phosphate compound ... explanation for the impaired Pi phosphorylation, which requires the occupation of the E2 state The severely impaired ADP-dependent dephosphorylation indicates that also the E1 state of the mutant ... sequenator Dephosphorylation assays The rate of dephosphorylation of the phosphoenzyme intermediate was determined both in the absence of ADP (dephosphorylation via the E2P intermediate) and in the...

8
500
0

The formation of the plural noun in English and Vietnamese equivalents

Ngày tải lên : 19/03/2014, 17:10

... and even the meaning of root noun This is not easy problem for learners I, myself, sometimes get confused at the formation of the plural nouns Thus, I decided to choose the formation of the plural ... without a system of theories and various examples from reference books and on the internet That are the ways I study my graduation paper Scope of the study Studying on the formation of the plural nouns ... Vietnamese equivalents as the topic for my graduation paper to compare the similarities and the differences between the ways of the formation of plural nouns and I hope that the study will help English...

77
733
3

Báo cáo khoa học: Cupiennin 1a, an antimicrobial peptide from the venom of the neotropical wandering spider Cupiennius salei, also inhibits the formation of nitric oxide by neuronal nitric oxide synthase pptx

Ngày tải lên : 23/03/2014, 09:21

... that of Ca2+-CaM [10,11,25,26], and therefore adversely affects binding of CaM to the Ca2+-CaM-binding domain of nNOS CaM is not only essential for the operation of nNOS and the other NOS isoforms, ... shown) The peak intensities for the bound and unbound conformations are approximately equal upon full saturation, further indicating that the complex is stable on the NMR timescale and exists in ... bind to this region of the peptide Furthermore, the hydrophobic face of the amphipathic N-terminal helix of cupiennin 1a has a signiﬁcant number of long-chain aliphatic or aromatic residues (L,...

7
366
0

Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc

Ngày tải lên : 29/03/2014, 21:20

... intermediate by direct attack at the anomeric centre In the next step, water is deprotonated by the general base catalyst and attacks the anomeric centre, releasing the carbohydrate moiety For GH36, the ... One unit of activity was dened as the amount of enzyme that liberates lmol pNP from pNPaGal per minute under these conditions Characterization of enzymatic properties The pH optimum of 0.27 nm ... 20 21 formation of storage oligosaccharides by transglycosylation using galactinol [O-a-d-Galp-(1 1)-l-myo-inositol] as the donor This relationship motivated the detailed analysis of the capacity...

14
579
0

Hints towards the formation of a more comprehensive theory of life. pptx

Ngày tải lên : 30/03/2014, 01:20

... hypothesis of Life, they ever act separately; but in the different modifications of Life, at one time the power of magnetism predominates, at another that of electricity, and at another that of ... either for analogies to the other, but for counterpoints On the same account, the nearer the common source, the greater the likeness; the farther the remove, the greater the opposition At the ... that they constitute, rather than subserve, their sensorium These eye-facets form the sense of light, rather than organs of seeing Their almost paradoxical number at Hints towards the formation...

40
448
0

Báo cáo khoa học: In vivo degradation of nitric oxide synthase (NOS) and heat shock protein 90 (HSP90) by calpain is modulated by the formation of a NOS–HSP90 heterocomplex pot

Ngày tải lên : 30/03/2014, 04:20

... both the inactivation and fragmentation of calpastatin are known to be produced by active calpain [32], these observations further indicate that calpain is activated in both tissues, although at ... lysates In order to explore the relationship between the HSP90 to NOS ratio and the formation of calpainresistant heterocomplexes, we ﬁrst studied, by immunoprecipitation analysis, the association ... report here that, in the brain and aorta of HSDtreated rats, the extent and patterns of proteolytic degradation of NOS isozymes and HSP90 are similar to those previously detected in Jurkat and BAE-1...

11
344
0

haunting the buddha indian popular religions and the formation of buddhism sep 2004

Ngày tải lên : 11/06/2014, 07:36

... in the others; I think it probable that the former are the coming to terms most ancient of the whole, and that the others have not been constructed till both the taste and the mythology of the ... due to the complex and often contradictory nature of the textual evidence Part of the problem stems from the fact that these religious practices were often local in nature and varied greatly from ... singularly out of place if regarded with the eyes of a Buddhist or Jaina monk But by the time that the necessity had arisen for the erection of these great monuments, with their illustrations of Buddhist...

241
319
0

báo cáo hóa học:" Direct effects of caffeine on osteoblastic cells metabolism: the possible causal effect of caffeine on the formation of osteoporosis" doc

Ngày tải lên : 20/06/2014, 00:20

... day, there was no statistically significant change in the formation of formazan; while in the 100 mM to mM concentration of caffeine, the formation of formazan was significantly decreased in the ... ribonuclease A] The cell lysates were then incubated at 37°C for h The genomic DNA was extracted by two separations, with phenol/chloroform and then with chloroform only The DNA pellet was then washed ... laddering pattern (in the size of 500 – 1000 bp) that led to cell death in the first day's culture; while in the concentrations of 0.5, 1.0 or 2.5 nM caffeine, the appearance of DAN fragmentation...

10
443
0

báo cáo hóa học:" The occurrence of osteoarthritis at a minimum of ten years after reconstruction of the anterior cruciate ligament" pdf

Ngày tải lên : 20/06/2014, 01:20

... with the non- injured contralateral knee, the fact that the patients were operated in a relatively short interval of time, the patients were evaluated by an independent unbiased investigator, the ... points) The patient with Lysholm 56 was the same who had VAS The KT 1000 arthrometer revealed in 55% of the patients A (1–2 mm), in 29 % of the patients B (3–5 mm) and in 16% of the patients ... to the contralateral side (Table and 4) The Fairbank classification showed an increase in osteoarthritis of grade in 52% of the patients, 35% of the patients had an increase of grades and 3% of...

9
426
0

The secrets of success at work 10 steps to accelerating your career potx

Ngày tải lên : 28/06/2014, 17:20

... a career of self-mortification by being seen as the worst of all mixes—arrogant and mediocre 10 THE SECRETS OF SUCCESS AT WORK You’ve got to accentuate the positive … These lyrics by the American ... do” list: You’ve got to accentuate the positive Eliminate the negative Latch on to the affirmative And don’t mess with Mr In-between Look in the mirror That’s the real you say hello and be ... good at or not so good at, and dislike or enjoy doing THE SECRETS OF SUCCESS AT WORK And here’s the list of things I want you to put in the appropriate quadrant: Data and math Writing reports Working...

177
468
0

the formation of the solar system theories old and new

Ngày tải lên : 06/07/2014, 15:31

... Man Ahead of his Time v FA1 August 30, 2007 10:19 spi-b525 The Formation of the Solar System 9in x 6in fm The Formation of the Solar System 3.4 3.5 Eratosthenes — The Man who Measured the Earth ... 30, 2007 10:19 spi-b525 The Formation of the Solar System 9in x 6in The Formation of the Solar System some of them were superﬁcially attractive they all failed because they contravened some important ... spi-b525 The Formation of the Solar System 9in x 6in ch01 The Formation of the Solar System For example, Newton wrote in his great scientiﬁc treatise Principia as one of his ‘Rules of Science’: “To the...

340
782
0

the formation of the solar system theories old and new

Ngày tải lên : 06/07/2014, 15:34

... Man Ahead of his Time v FA1 August 30, 2007 10:19 spi-b525 The Formation of the Solar System 9in x 6in fm The Formation of the Solar System 3.4 3.5 Eratosthenes — The Man who Measured the Earth ... 30, 2007 10:19 spi-b525 The Formation of the Solar System 9in x 6in The Formation of the Solar System some of them were superﬁcially attractive they all failed because they contravened some important ... spi-b525 The Formation of the Solar System 9in x 6in ch01 The Formation of the Solar System For example, Newton wrote in his great scientiﬁc treatise Principia as one of his ‘Rules of Science’: “To the...

340
3.9K
1

Báo cáo vật lý: "Effects of Electrolyte Natures on the Formation of Well-Ordered Titania Nanotubes Produced Via Anodisation" potx

Ngày tải lên : 07/08/2014, 14:20

... area of the electrodes was cm2 The distance between the cathodic and anodic electrodes was 30 mm A schematic representation of the anodisation setup is shown in Figure The bath consisted of either ... great The cracking of the oxide layer from the substrate was also due to the unsuitable cooling rate when the sample was cooled to room temperature Figures 10a and 10b show the XRD pattern of the ... originated from the foil The XRD pattern of the sample after annealing showed anatase peaks and Ti-peaks Ti-peaks were again present because the information from the substrate was revealed The anatase...

11
173
0