the first law of thermodynamics is a restatement of the
Tài liệu Chapter XV The First Law of Thermodynamics pdf
... constantPV)(11)()(2211221121VPVPVPVPRCTTnCWVV120lnVVnRTWQ4/29/2008 2Chapter XV The First Law of Thermodynamics §1. Heat, work and paths of a thermodynamic process§2. The first law of thermodynamics §3. Kinds of thermodynamic processes§4. Thermodynamic processes ... processes for an ideal gas4/29/2008 26Summary The first law of thermodynamics: ΔU = Q - W The change of internal energy The quantity of heat addedto the system The work doneby the system The work ... Calculation of work done during volume changes: A typical example of a thermodynamic system is an amount of gas enclosed in a cylinderwith a movable piston. (Such a system is the central part...
- 27
- 597
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... oligo-merization domain (i.e. b sheets 7 and 8, the AAAdomain helix and the C-terminal helix). However, the majority of these proteins are likely to be other meioticclade AAA ATPases and have the AAA ... domain helixand the C-terminal helix, but not the b domain. The distinguishing feature of members of the meioticclade of AAA ATPases is the SRH motif, which dif-fers from that of other AAA ATPases ... material is availableonline:Fig. S1. Sequence alignment of the C-terminal regions of Vps4, spastin, katanin and fidgetin from a range of species.This material is available as part of the online articlefrom...
- 23
- 490
- 0
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx
... Comparini C, Calamassi R, Pazzagli L,Cappugi G & Scala A (2004) Cerato-platanin protein is located in the cell walls of ascospores, conidia andhyphae of Ceratocystis fimbriata f. sp. Platani. ... cerato-platanin domain, and a blastp search always yielded the members of the cera-to-platanin family as the best hits. It is possible thatthey represent an ancestral cerato-platanin memberthat is ... confrontation assays, osmotic stress and starva-tion. Although the TrichoEST database comprisesESTs of several Hypocrea ⁄ Trichoderma species, and the genome database of H. jecorina is available,...
- 14
- 494
- 0
Tài liệu Chiếu sáng trong truyền hình - Television Lighting Television is a means of changing pptx
... situations. To mask some of the noise at low light levels, consumer cameras often use a setup, or black level, of zero IRE, rather than the 7.5 IRE broadcast standard. Some cameras that automatically ... scene have the same color temperature. A combination of filters and electronic adjustments is used to adapt color cameras to each new lighting situation. Most cameras can adjust automatically to ... near the subject and pointed toward the camera. The minimum acceptable level for color television depends on the ability of the lens to transmit light to the camera, the sensitivity of the...
- 6
- 462
- 1
Learning english is a piece of cake 1
... raɪz njuː wɜːdz and grammatical rules. In fact, learning English can be a piece of cake. ənd ɡrə ˈmæt ɪk əl ruːlz ɪn fækt ˈlɝːn ɪŋ ˈɪŋ ɡlɪʃ kæn biː ə piːs ʌv keɪk Don’t worry about ... worry about pronunciation. Don’t worry about grammar. doʊnt ˈwɝːɪ ə ˈbaʊt prə ˌnʌnts i ˈeɪʃ ən. doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes. Just try to speak. doʊnt biː ə ... want to improve my English! Many people are worried about learning English. ˈmen i ˈpiːpl ɑːr ˈwʌrid ə ˈbaʊt ˈlɝːn ɪŋ ˈɪŋ ɡlɪʃ They think English is difficult and it’s hard to memorize new...
- 2
- 1,666
- 15
Shooting the Sacred Cows of Money Putting a bullet in the head of bad financial advice
... Tom is an international speaker and anadjunctprofessorin the Masters of TaxprogramatArizonaStateUniversity.Heservesas the RichDadAdvisorforTaxandWealthStrategyand is the author of anupcomingRichDadAdvisorbookonbuildingwealththroughtaxstrategies. ... industry was born called nancial planners. Today it takes 30 days to become a nancial planner. It still takes a year and a half to become a massage therapist. RobertAndy,whatdoyouthink of mutualfunds?Andy ... my house had appreciated in value. Again, that’s capital gains versus cash ow. And what peoplearendingoutnowthat the realestatemarkethascrashedand the value of homeshasbeensuckedout…nowpeopleareupsidedownontheirhome,andthey’rendingoutit’s a liabilitybecausetheystillhavetopay the bankonthat...
- 38
- 492
- 0
Tài liệu The Man of Letters as a Man of Business docx
... that there is always a dangerthat the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and thatif the magazine is not to pass away with the ... rightalong," as the English boys at Oxford made an American collegian say in a theme which they imagined forhim in his national parlance; and the man of letters, as an artist, is apt to have ... necessity rather than the ideal of the paragrapher, and that the notoriety the journalists bestow upon him is not the measure of theiracquaintance with his work, far less his meaning. They are good...
- 21
- 544
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCCGCGGGATCCCGGATGCTGGCAGCGTGGGTTGGpYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ... GCGGGATCCCACACCATTTTGCTGGTACAATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTGpGEX-4T1 ⁄ PDIP46 ⁄ SKAR(L7) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGpEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTTGCGGGATCCCGTTTCCCAGCCTGTTGGGCCTpEGFP-N1 ... GCGGGATCCGTGAATAATCTGCACCCTCGAATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ⁄ PDIP46 ⁄ SKAR(D) GCGGGATCCCTCAGCCCATTGGAAGGCACCATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAGpYESTrp2 ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCCpYESTrp2...
- 14
- 517
- 0
Selecting the best anthropometric variables to characterize a population of healthy elderly persons ppt
... es la selección de las variables antropométri-cas más adecuadas para caracterizar poblaciones sanas depersonas mayores. Para ello se han seleccionado aleatoria-mente 1030 de estas personas ... nificant factors (with eigenvaluesgreater than unity) that are capable of explaining 94.5% of the variance and thus most of the infor mation in the original data set. The new “latent” factors are ... Chemistry. Faculty of Sciences. University of Valladolid. Valladolid. Spain.SELECCIÓN DE LAS VARIABLESANTROPOMÉTRICAS MÁS ADECUADASPARA CARACTERIZAR UNA POBLACIÓNDE PERSONAS MAYORES SANASResumenEl...
- 8
- 544
- 0
Báo cáo khoa học: The N-terminal region of the bacterial DNA polymerase PolC features a pair of domains, both distantly related to domain V of the DNA polymerase III s subunit ppt
... structures of PolIIIs-V and DnaA-I adopt a vari-ant of the so-called type II KH fold [21]. One of theirmajor differences from classical type II KH domains is the absence of the characteristic GXXG ... The actual DNA synthesis is performed by the catalytic a- subunit (PolIIIa), which belongs to the C-family of DNA polymerases [2]. Polymerases of the C-family fall into two major groups, DnaE and ... III andinteraction with the alpha subunit. Nucleic Acids Res35, 2825–2832.20 Abe Y, Jo T, Matsuda Y, Matsunaga C, Katayama T& Ueda T (2007) Structure and function of DnaAN-terminal domains:...
- 10
- 419
- 0
Báo cáo khoa học: A novel metallocarboxypeptidase-like enzyme from the marine annelid Sabellastarte magnifica – a step into the invertebrate world of proteases pdf
... annulata, Budonosoma granulifera, Cassiopeaxamachana, Condylactys gigantea, Gorgonia ventalina,Lebrunia danae, Palythoa caribaeorum, Physalia phy-salis, Plexaura homomalla, Stichodactyla helianthus ... magnifica Phylum Annelida, Class Polychaeta, SubclassPalpata, Order Canalipalpata, Suborder Sabellida, Family Sabellidae,Genus Sabellastarte [14] The ‘tentacle crown’ and the ‘body’ parts of ... the kingdom Methazoa(Phyla: Annelida, Urochordata, Echinodermata, Cnidaria,Mollusca, Artropoda) were collected in the north coast of Havana and classified by Cuban specialists at the NationalInstitute...
- 16
- 628
- 0
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot
... inverted terminal repeat amplification were:1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGCATGGC-3¢; and AAV65MGB/taq, 5¢-GTTAATGATTTable 1. Primers and probe sets ... CGCTTTCGGAGGTGCTTTCGCAGM1941p65.R: TCAGAGTTCCCTACCGAAGCAGP0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGAM225PO.P: CCGTGGTGCTGATGGGCAAGAAM267PO.R: ACCATGATGCGCAAGGCCATp21WAF1/CIP1Cyclin-dependent ... sequence of CARP was obtained by PCRamplification using mouse cDNA extracted from muscle of a 129SvTer mouse as a template. The primers usedwere 5¢-CACCATGATGGTACTGAGAG-3¢ and 5¢-GAATGTAGCTATGCGAGAGTTC-3¢....
- 16
- 428
- 0
The Fathers of New England A Chronicle of the Puritan Commonwealths doc
... erected a palisaded embankment with four bastions, a housefor the garrison, and a place for a battery; later he leveled the hill on Castle Island in the harbor, and builtthere a similar palisade and ... large part to the mother country.She established councils and committees of trade and plantations, and, by the seizure of New Netherland in1664 and the grant of the Carolinas and the Bahamas ... educate their children; they disapproved of the lax Dutch observance of Sunday and saw in the temptations of the place a menace to the habits and morals of the younger members of the flock, and,...
- 71
- 483
- 0
the influence of corporate culture of vietnamese companies a study of corporation fpt
... The highest one and also the visible part of the iceberg is artifact. At the surface, they are visible artifacts and observable behaviors – mission statement, architecture, narratives, language, ... evaluation is a bit insufficient. In this thesis, the writer has also proposed a qualitative study of the concept. In the qualitative thesis, organizational culture is a multi-level. It is ... Symbol Language Narrative Ceremonies Behaviors 12 2.2.1.4 Language CC is first created through the use of language in the creation of a shared vision which is articulated in a firm mission...
- 77
- 1,356
- 14
- the first law of thermodynamics states that energy in a system is
- the first law of thermodynamics is generally referred to as
- the first law of thermodynamics is related to the conservation of which quantity
- the first law of thermodynamics states that energy is constant
- the first law of thermodynamics states that the energy of the universe is
- the first law of thermodynamics states that energy is constant it can
- the first law of thermodynamics is a restatement of which of these laws
- the first law of thermodynamics is a restatement of the quizlet
- the first law of thermodynamics is a restatement of the law of conservation of momentum
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose