the first law of thermodynamics is a restatement of the law of conservation of
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... oligo-merization domain (i.e. b sheets 7 and 8, the AAAdomain helix and the C-terminal helix). However, the majority of these proteins are likely to be other meioticclade AAA ATPases and have the AAA ... domain helixand the C-terminal helix, but not the b domain. The distinguishing feature of members of the meioticclade of AAA ATPases is the SRH motif, which dif-fers from that of other AAA ATPases ... material is availableonline:Fig. S1. Sequence alignment of the C-terminal regions of Vps4, spastin, katanin and fidgetin from a range of species.This material is available as part of the online articlefrom...
- 23
- 490
- 0
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt
... S. & Fire, A. (1998) RNA as a target of double-stranded RNA-mediated genetic interference in Cae-norhabditis elegans. Proc.NatlAcad.Sci.USA95, 15502–15507.44. Tabara, H., Grishok, A. & ... indicated by the open arrowhead, and the Ku-70 and -80 proteins are indicated by closedarrowheads. In addition, the asterisks represent reappearance of the WD proteins after 24 h (upper panel). The ... amplifi-cation was performed using LA Taq (Takara, Japan) in a total volume of 50 lL containing 55 pg of competitor. Atthis concentration, the band intensity of the amplifiedproduct from the competitor...
- 11
- 628
- 0
Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc
... phosphorylase, causes a large activation of glycogensynthase but a small stimulation of glycogen synthesis; (c)that the stimulation of glycogen synthesis by inactivation of phosphorylase is associated ... with both activation andtranslocation of glycogen synthase, and that the formermechanism alone cannot explain the stimulation of glyco-gen synthesis. This suggests that translocation of glycogensynthase ... of the phosphorylase inactivator, we suggest thatadditional factors may be involved in translocation of glycogen synthase and that phosphorylase a itself may be animportant determinant of the...
- 9
- 381
- 0
university of california press a critical history of early rome from prehistory to the first punic war feb 2005
... some archaeologists as an indicationthat cremating people had come into Italy by sea, and that their migrationwas part of the larger upheaval which affected the eastern Mediterraneanat the ... integral aspect of the Villanovan Culture of northern and much of central Italy. Was the widespread practice of crema-tion during the Final Bronze Age a passing fad, so to speak, adopted andthen ... been able to arriveat many firm conclusions about the overall character of these languagesand their historical links to one another.1Before Latin began to drive the other languages of ancient...
- 421
- 379
- 0
Shooting the Sacred Cows of Money Putting a bullet in the head of bad financial advice
... Tom is an international speaker and anadjunctprofessorin the Masters of TaxprogramatArizonaStateUniversity.Heservesas the RichDadAdvisorforTaxandWealthStrategyand is the author of anupcomingRichDadAdvisorbookonbuildingwealththroughtaxstrategies. ... industry was born called nancial planners. Today it takes 30 days to become a nancial planner. It still takes a year and a half to become a massage therapist. RobertAndy,whatdoyouthink of mutualfunds?Andy ... my house had appreciated in value. Again, that’s capital gains versus cash ow. And what peoplearendingoutnowthat the realestatemarkethascrashedand the value of homeshasbeensuckedout…nowpeopleareupsidedownontheirhome,andthey’rendingoutit’s a liabilitybecausetheystillhavetopay the bankonthat...
- 38
- 492
- 0
Tài liệu Adopting a Rescue Dog - The First Seven Days From Shelter to Home pdf
... to adopt a black dog and wanted one a bit more mature as I was in an apartment. Lissa had been found, initially reunited with her family, and then they brought her back to the shelter a couple ... thinking about a small dog. Neither of our adult children have pets and perhaps they could take the dog while we are in South Africa. at night I was on the SPCA website for Northern Virginia. And ... eu-thanized is a “behavior problem”. Most behavior problems can be prevented by appropriate socialization and training, under the guidance of a quali ed trainer. is takes a heavy investment of time,...
- 107
- 326
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCCGCGGGATCCCGGATGCTGGCAGCGTGGGTTGGpYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ... GCGGGATCCCACACCATTTTGCTGGTACAATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTGpGEX-4T1 ⁄ PDIP46 ⁄ SKAR(L7) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGpEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTTGCGGGATCCCGTTTCCCAGCCTGTTGGGCCTpEGFP-N1 ... GCGGGATCCGTGAATAATCTGCACCCTCGAATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ⁄ PDIP46 ⁄ SKAR(D) GCGGGATCCCTCAGCCCATTGGAAGGCACCATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAGpYESTrp2 ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCCpYESTrp2...
- 14
- 517
- 0
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... evolutionary analysis of the DNase I family. The mammalian group formed a relatively tight cluster, while the snake (E. quadrivirgata,E. climacophora and A. blomhoffii), amphibian (X. laevis,Rana catesbeiana, ... quadrivirgata,E. climacophoraand A. blomhoffiiDNases ITotal RNA was isolated from each snake pancreas by the acid guanidinium thiocyanate/phenol/chloroform method[24] and any DNA contamination was ... reagent grade and available commercially. The snakes and Japanese white rabbits were acquired, main-tained and used in accordance with the Guidelines for the Care and Use of Laboratory Animals...
- 8
- 500
- 0
Báo cáo khoa học: A novel metallocarboxypeptidase-like enzyme from the marine annelid Sabellastarte magnifica – a step into the invertebrate world of proteases pdf
... annulata, Budonosoma granulifera, Cassiopeaxamachana, Condylactys gigantea, Gorgonia ventalina,Lebrunia danae, Palythoa caribaeorum, Physalia phy-salis, Plexaura homomalla, Stichodactyla helianthus ... magnifica Phylum Annelida, Class Polychaeta, SubclassPalpata, Order Canalipalpata, Suborder Sabellida, Family Sabellidae,Genus Sabellastarte [14] The ‘tentacle crown’ and the ‘body’ parts of ... the kingdom Methazoa(Phyla: Annelida, Urochordata, Echinodermata, Cnidaria,Mollusca, Artropoda) were collected in the north coast of Havana and classified by Cuban specialists at the NationalInstitute...
- 16
- 628
- 0
Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx
... reason for this phenomenon (namely enzymeinstability) is discussed in greater detail below.Instability of the mutant enzymeFurther analysis of the kinetic parameters of the G167Emutant was ... destabilization of the ISP [14].It seems probable that this is also the case for the G167Emutant, and that activity is lost owing to the destabilization of the complex (loss of the ISP) on dilution ... mitochondria. Studies of the mechanism of assembly of the bc1complex suggest that the ISP is one of the lastsubunits to be integrated within the membrane-boundsubcomplex [2]. The integration of the...
- 7
- 498
- 0
Báo cáo khoa học: Investigations on the evolutionary conservation of PCSK9 reveal a functionally important protrusion pot
... proteins in the marine Califor-nia sea slug (Aplysia californica) and in the freshwatersnail Biomphalaria glabrata. These CRD homologswere extracted from ESTs from the Aplysia ESTproject and the ... 5)appeared to migrate normally. To study whether the abnormal migration of the mature forms of R19 4A- PCSK9 and D20 4A- PCSK9 was due to altered auto-catalytic cleavage, western blot analyses of ... two mutants were autocat-alytically cleaved in a normal fashion.To study whether the abnormal migration of mature, cleaved R19 4A- PCSK9 and D20 4A- PCSK9was due to abnormal glycosylation, the sensitivities...
- 13
- 378
- 0
DECONSTRUCTING MORALITY: A DISCOURSE ON THE FIRST ESSAY
... UNEGOISTIC ACTSA21 // On the Genealogy of Morals, First Essay Castillo / Saw / Paris / Tan / Medina, K BEGAN AFTERUTILITARIANISMMASTER MORALITYSA21 // On the Genealogy of Morals, First Essay ... WAR BETWEEN THE RICH AND THE POOR.SO THE GOOD-CONTRARY POLARITY BECAME A. K .A. THE MASTERS AND THE SLAVES.SA21 // On the Genealogy of Morals, First Essay Castillo / Saw / Paris / Tan / Medina, ... Morals, First Essay Castillo / Saw / Paris / Tan / Medina, KAS A VITAL SOCIAL COMPONENT, LANGUAGE ADAPTS TO ITS USERS.SA21 // On the Genealogy of Morals, First Essay Castillo / Saw / Paris...
- 46
- 267
- 0
báo cáo sinh học:" Burnout and training satisfaction of medical residents in Greece: will the European Work Time Directive make a difference?" pot
... Mariolis A, Mihas C, Alevizos A, Papathanasiou M, Mariolis-Sapsakos T, Marayiannis K, Koutsilieris M: Evaluation of a clinical attachment in Primary Health Care as a component of undergraduate ... continuous variables. The choice of meth-ods for statistical testing of continuous variables wasbased on whether the data permitted parametric or non-parametric analysis. Categorical variables were ... interests.Authors' contributionsPM and NCK conceived and coordinated the study and drafted the paper; PMcarried out the mathematical analysis; AT, DK, NS, NP and ET collected data andassisted...
- 11
- 380
- 0
báo cáo hóa học: " Development and validation of a French patient-based health-related quality of life instrument in kidney transplant: the ReTransQoL" pot
... transplantation produce quality of lifebenefits? A quantitative analysis of literature. Transplantation1997, 64:1261-1273.15. Fujisawa M, Ichikawa Y, Yoshiya K, Isotani S, Higuchi A, Nagano ... consist-encies.Construct validity- Factor analysis The factor analysis with varimax rotation identified a structure of five factors, which accounts for 46.3% of the total variance (Table 4). The content of each dimensionwas ... interpreted the data,drafted the manuscript; EJ participated in the design of the study, collected the data and performed the statisticalanalysis BD and VM: participated in the design of the study,...
- 12
- 520
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25