the fifo method is also acceptable and can be used if the company considers this more appropriate for management purposes the company shall use the same allocation method for all inventories having a similar nature and use

báo cáo khoa học: "Why don’t hospital staff activate the rapid response system (RRS)? How frequently is it needed and can the process be improved?" potx

báo cáo khoa học: "Why don’t hospital staff activate the rapid response system (RRS)? How frequently is it needed and can the process be improved?" potx

Ngày tải lên : 10/08/2014, 10:23
... responses before and after the intervention on the pilot wards will be analysed using a one-way repeated measures ANOVA Prospective audit Analysis of all unplanned ICU admissions and cardiac arrests ... a substantial effect on the culture of the clinical area If the team is negative and critical, the ward staff may be reluctant to call for help on future occasions, whereas a helpful team that ... interpersonal interactions during MET calls also may have a detrimental effect on future optimal MET call behaviour amongst staff For example, the attitude of the MET call team on their arrival may have...
  • 7
  • 436
  • 0
Báo cáo y học: " The electronic version of this article is the complete one and can be found onlin" pot

Báo cáo y học: " The electronic version of this article is the complete one and can be found onlin" pot

Ngày tải lên : 14/08/2014, 08:20
... because the physical chemists speak a different jargon from synthetic organic chemists and so on And he says that biologists are better off because most biologists can go to any talk by any other ... chemists and physicists and hardly any chemists and physicists know what to make of the typical biology seminar, with its lists of gene names and gel slides and acronyms that don’t stand for anything ... and have a ball Clifford: Ball?? Throw the ball! Throw the ball!! Mink: For Pete’s sake, get a grip Anyway, I think that Greg’s forgotten something very important He’s forgotten that in the age...
  • 2
  • 190
  • 0
Báo cáo y học: "The electronic version of this article is the complete one and can be found online" potx

Báo cáo y học: "The electronic version of this article is the complete one and can be found online" potx

Ngày tải lên : 14/08/2014, 08:21
... Drosophila Dally and Dally-like protein are encoded on the same chromosome, but are far more distantly linked than are the mammalian clusters Glypican proteins are between 555 and 580 amino acids ... in the near future is the cellular and molecular basis of the context specificity that characterizes glypican activity For example, what is the reason for the opposite effects of GPC3 and Dally-like ... stimulates Hh signaling, although the mechanism of this stimulatory activity remains unknown [37] Because the HS chains have a strong negative charge, HS proteoglycans can interact in a rather...
  • 6
  • 390
  • 0
Báo cáo y học: "The electronic version of this article is the complete one and can be found online at" pps

Báo cáo y học: "The electronic version of this article is the complete one and can be found online at" pps

Ngày tải lên : 14/08/2014, 14:21
... DD|395578 DV|206272 CTGTTGACAGTGTAAGGTGAGCTTTGTTAAATATCTCACAAGCGCA-CGGGCCAACGAACTCGTAAAAGTCTCCGTTAGGCA CGCTTGACACATCAGGGGTGACATTGTTAATTCCATCACAAGCGCAGCGGGCTCCCCA -CAACGAAGTGTT G * ****** * ** ... DD|394579 DV|206736 CCTACATTGCAAAAACTATAATT TTCGGAGGATGGAAGCTATGTCCAATTTGGTCCCCCCTCATGGCGGTAAAG CGGACGGTGTCAACAACATCACGCATCTGGAGGATGTAAGGTATGTCCAAGCTGGTTCCCGCTCATGGTGGTAAGG * ** ** ** * ** * * ... DD|395578 DV|206272 GGCCAAACAGGTTAAACCCTTAATTCCGTTTGTGTTGGAGGAATAGGTATGCCGACTTATGTTGATCCGTCCAAGTGTGATG -GCCAAGCA -AACCCTTAATTCTGTTTGAGTTGGAGGATAAGGTATGCCGACTTATGTTGATCCGTCCAAGTGCGACG ***** ** ************...
  • 27
  • 356
  • 0
Báo cáo y học: "Radiographic joint damage in rheumatoid arthritis is associated with differences in cartilage turnover and can be predicted by serum biomarkers: an evaluation from 1 to 4 years after diagnosis" pot

Báo cáo y học: "Radiographic joint damage in rheumatoid arthritis is associated with differences in cartilage turnover and can be predicted by serum biomarkers: an evaluation from 1 to 4 years after diagnosis" pot

Ngày tải lên : 09/08/2014, 07:20
... onset [4] Radiographs only reveal gross anatomical changes It usually takes at least one year before significant changes in joint damage can be observed This delay means there is a need for more sensitive ... biomarkers associated with cartilage breakdown measured at diagnosis, and before treatment, should also be evaluated In general, the identification of biomarkers that can be used as a prognostic ... CS846-epitope, and CPII All assays are described and were used as recommended by the manufacturer (Ibex, Montreal, Canada) Clinical variables Spearman rank correlations were calculated to determine...
  • 9
  • 525
  • 0
Báo cáo khoa học: "Density of CD4(+) and CD8(+) T lymphocytes in biopsy samples can be a predictor of pathological response to chemoradiotherapy (CRT) for rectal cancer" ppt

Báo cáo khoa học: "Density of CD4(+) and CD8(+) T lymphocytes in biopsy samples can be a predictor of pathological response to chemoradiotherapy (CRT) for rectal cancer" ppt

Ngày tải lên : 09/08/2014, 09:20
... immunostaining and data analysis HN participated in the management of this study All authors read and approved the final manuscript Page of Competing interests The authors declare that they have ... and Technology of Japan, and the Ministry of Health, Labor and Welfare of Japan Authors’ contributions JK participated in the study design and data retrieval and analysis KY, KK, ES participated ... performed before and after CRT, the longitudinal dimension of the rectal tumor was measured on BE images before (A) and after (B) CRT, and the reduction rate was calculated as (A- B) /A Biopsy samples...
  • 6
  • 371
  • 0
Báo cáo y học: "Granulocyte-CSF induced inflammation-associated cardiac thrombosis in iron loading mouse heart and can be attenuated by statin therapy" pptx

Báo cáo y học: "Granulocyte-CSF induced inflammation-associated cardiac thrombosis in iron loading mouse heart and can be attenuated by statin therapy" pptx

Ngày tải lên : 10/08/2014, 05:21
... Qin Y, Takano H, Minamino T, Zou Y, Toko H, Ohtsuka M, Matsuura K, Sano M, Nishi J, Iwanaga K, Akazawa H, Kunieda T, Zhu W, Hasegawa H, Kunisada K, Nagai T, Nakaya H, Yamauchi-Takihara K, Komuro ... 5’- CAG CCA GAT GCA GTT AAC GC -3’, and antisense, 5’- GCC TAC TCA TTG GGA TCA TCT TG -3’); tissue factor sense, 5’- AAG GAT GTG ACC TGG GCC TAT GAA -3’, and antisense, 5’- ACT GCT GAA TTA CTG ... (PBS containing 1%formaldehyde and 1% FBS) for flow analysis Statistical analysis was done by SPSS for Windows (version 12.0) All data are described as means ± standard deviation (S.D.) The two...
  • 15
  • 342
  • 0
Game on: How  gaming can be used to make my product more engaging

Game on: How gaming can be used to make my product more engaging

Ngày tải lên : 03/07/2014, 14:47
... product more engaging? DESIGNER I can t wait for the next great gaming experience! GAMER ARe YOU MOBILE ARe YOU CASUAL ARe YOU AVID How can I use gaming to make my product more engaging? DESIGNER ... gameplay gamification gamify game layer game theory gamestorming YOU ARE HERE http://en.wikipedia.org/wiki/Hype_cycle http://meta.gamify.com/ How I make boring stuff fun? FLASH HTML5 gamification ... SOCIAL WEB 2.0 gamification the use of game play mechanics for non-game applications, particularly consumer-oriented web and mobile sites, in order to encourage people to adopt the applications.”...
  • 172
  • 366
  • 0
Báo cáo khoa học: "Pro/con debate: In patients who are potential candidates for organ donation after cardiac death, starting medications and/or interventions for the sole purpose of making the organs more viable is an acceptable practice" doc

Báo cáo khoa học: "Pro/con debate: In patients who are potential candidates for organ donation after cardiac death, starting medications and/or interventions for the sole purpose of making the organs more viable is an acceptable practice" doc

Ngày tải lên : 13/08/2014, 03:20
... Cardiocirculatory Death: A Canadian Forum: Donation after Cardiocirculatory Death: A Canadian Forum: Report and Recommendations Edmonton: The Canadian Council for Donation and Transplantation; 2005 ... heparin administration at the time of withdrawal of lifesustaining treatment as the current standard of care [3,7] The acceptability of these practices should be evaluated according to Beauchamp ... grief [17], these reasons are also not for the benefit of the patient Page of (page number not for citation purposes) Is there potential harm to the donor (a hastening of death as a primary consequence)?...
  • 4
  • 301
  • 0
Besides increasing the number of universities,rasing the education quality is also urgent problem

Besides increasing the number of universities,rasing the education quality is also urgent problem

Ngày tải lên : 19/07/2013, 16:34
... SUMMARIES 1 .The Ministry of Education and Training and the Vietnam Education builed the campaign to help pupils in disadvantaged areas The campaign attracted teacher and students’ participation ... right before the new school year To help pupils in disavantaged regions , especially in flood-hit areas, the Ministry of Education and Training and the Vietnam Education Trade Union have called for ... encouraged teacher to change the method of teaching - SUPPORTING STUDENTS IN DISADVANTAGED AREAS The Ministry of Education an Training and the Vietnam Education Trade Union have called for support...
  • 21
  • 427
  • 0
Tài liệu The Decline in the U.S. Personal Saving Rate: Is It Real and Is It a Puzzle? pptx

Tài liệu The Decline in the U.S. Personal Saving Rate: Is It Real and Is It a Puzzle? pptx

Ngày tải lên : 16/02/2014, 11:20
... only the United States: Similar dynamics also characterize, for instance, Canada and Australia.24 In particular, the Australian saving rate has been negative since 2002 Furthermore, the Canadian ... may be explained away by this structural change in the way stockholders are compensated However, the trend is rather recent and, although the saving rate has been falling at least since the early ... of the acquisition costs and of the capital gains cumulated on the stock of existing wealth For some types of applications (and policy analysis) this seems to be an appropriate notion For instance,...
  • 24
  • 500
  • 0
the method of investment appraisal which may be applied to evaluated and rank potential investment opportunities and their relative merits and limitations

the method of investment appraisal which may be applied to evaluated and rank potential investment opportunities and their relative merits and limitations

Ngày tải lên : 17/02/2014, 13:02
... companies all look toward a high market share, because it allows them to have advantage in price competitive The acquisition of a large competitor is a reasonable way to quickly attain significant market ... recovered, the more desirable is the investment The payback period is expressed in years When the net annual cash inflow is the same every year, the following formula can be used to calculate the payback ... databases This is defensible knowledge base that gives a company a competitive advantage, and is one of the best reasons to acquire a company • International alternative A company may have an extremely...
  • 17
  • 575
  • 0
Tài liệu The future of cinema is smooth, crisp and amazing docx

Tài liệu The future of cinema is smooth, crisp and amazing docx

Ngày tải lên : 19/02/2014, 10:20
... Christie in leading the global R&D effort to make the industry ready for this big shift – from the film set and all the way to the local movieplex That 24 FPS standard is still around today, almost ... events and concerts The Christie Solaria™ 2.2 software is a firmware upgrade that requires zero down-time to make the changes Your local technical partner can handle the upgrade, or theater operators ... fits in a spare slot already designed into Christie Solaria Series projectors A technical partner or theater operator can easily pop open a blank faceplate and snap the module into place, again with...
  • 8
  • 639
  • 0
Project Gutenberg’s Philosophy and Fun of Algebra, by Mary Everest Boole This eBook is for the use pdf

Project Gutenberg’s Philosophy and Fun of Algebra, by Mary Everest Boole This eBook is for the use pdf

Ngày tải lên : 15/03/2014, 00:20
... pasting a tape over the crack between them This tape forms a hinge You can lay one card flat and stand the other edgeways upright, and lace patterns between them from one to the other The use of this ... the right end He has made an Algebra for himself And the best wish one can make for his future is that he will go on doing the same for the rest of his life Perhaps the best way of teaching a ... mathematicians can weigh the earth and measure the stars, and reveal the laws of the universe; and tell yourself that it is all one science, and that you are one of the servants of it, quite as...
  • 56
  • 474
  • 0
The Research Tax Credit’s Design and Administration Can Be Improved potx

The Research Tax Credit’s Design and Administration Can Be Improved potx

Ngày tải lên : 15/03/2014, 07:20
... than the amount that the taxpayer would have spent anyway, all of the credit paid is a windfall and no additional spending is stimulated because no incentive is provided at the margin In contrast, ... shall be treated as a single taxpayer,6 and The credit (if any) allowable under this section to each such member shall be its proportionate share of the qualified research expenses and basic research ... until the base is updated again, the situation is likely to gradually approach that which existed under 2009 law No minimum base and Raising the rate of the ASC to 20 percent Same as above in the...
  • 119
  • 1.7K
  • 0
Báo cáo khoa học: The antibody to GD3 ganglioside, R24, is rapidly endocytosed and recycled to the plasma membrane via the endocytic recycling compartment ppt

Báo cáo khoa học: The antibody to GD3 ganglioside, R24, is rapidly endocytosed and recycled to the plasma membrane via the endocytic recycling compartment ppt

Ngày tải lên : 16/03/2014, 13:20
... tumor-associated gangliosides are being used as therapeutic agents, for example, anti-GD2 for neuroblastoma [11] and antiGD3 for melanoma [12,13] Several targeted therapies need the antibody to remain at the ... perinuclear distribution After 30 at 37 °C, the intracellular pool of R24 became more concentrated in the perinuclear region and the plasma membrane mark almost disappeared (Fig 1A) At 60 after the beginning ... shape and membrane-order parameters [40] GD3–R24 interactions with a protein may cause the lipid to be sorted on the basis of the characteristics of the protein, and such a mechanism is important...
  • 15
  • 329
  • 0
How can children be obese and hungry at the same time? pot

How can children be obese and hungry at the same time? pot

Ngày tải lên : 17/03/2014, 17:20
... obese children between the ages of 10 and 17 This data, collected from the CDC Behavioral Risk Factor Surveillance System, also showed that African-Americans and Hispanics respectively had a ... hypertension, cancer and heart disease “Our affiliate usually focuses on programs that work to narrow the academic achievement gap in the African American community,” said June Swanston-Valdes, continued ... one or the other For more information about hunger and obesity, and to advocate for federal and state nutrition programs that help combat both problems, please visit the Food Research and Action...
  • 16
  • 440
  • 0
Báo cáo khoa học: Caspase-2 is resistant to inhibition by inhibitor of apoptosis proteins (IAPs) and can activate caspase-7 pot

Báo cáo khoa học: Caspase-2 is resistant to inhibition by inhibitor of apoptosis proteins (IAPs) and can activate caspase-7 pot

Ngày tải lên : 23/03/2014, 13:20
... et al respectively pGALL-(HIS3)-Caspase-2D31 6A, pGALL(HIS3)-Caspase-2D33 0A, pGALL-(HIS3)-Caspase-2D316,33 0A, pGALL-(HIS3)-Caspase-2D152,316,33 0A, pGALL-(URA)-Caspase-2D31 6A, pGALL-(URA)-Caspase-2D33 0A, ... 5¢-CCCTCGAGTTTAAT TGTGTTTAATATTAC-3¢; 28, 5¢-GCGGATCCATGACT TTTAACAGTTTTGAAGG-3¢; 29, 5¢-GAGAATTCTTAA GACATAAAAATTTTTTGCTTG-3¢; 30, 5¢-GCCTGCAG ACTGCTGGCAACCGCAGCAGCCACTCGAGG-3¢; 31, 5¢-GCCTGCAGCAGCTGCTCCAGGGCAGTGGCCAGG ... caspase-7 and is resistant to IAPs 24, 5¢-GAGATCTCATATGAATAAAGATGGTCCTGTC TGC-3¢; 25, 5¢-GGCAGATCTCATATGAATAAAGCT GGTCCTGTCTGC-3¢; 26, 5¢-GGAATTCCATATGTGTG TAATTTTTCCGGTAG-3¢; 27, 5¢-CCCTCGAGTTTAAT...
  • 14
  • 348
  • 0
This factsheet is not exhaustive and does not bind the Court pot

This factsheet is not exhaustive and does not bind the Court pot

Ngày tải lên : 28/03/2014, 16:20
... that Polish domestic law allowed for abortion in cases of foetal malformation, there had to be an adequate legal and procedural framework to guarantee that relevant, full and reliable information ... particular due to the lack of a clear legal framework, procrastination of medical staff and also as a result of harassment Violation of Article (right to respect for private and family life) The ... held in particular that the applicants had been given misleading and contradictory information and had not received objective medical counselling; and, the fact that access to abortion was a subject...
  • 5
  • 340
  • 0

Xem thêm